Báo cáo sinh học: "Electroporation increases antitumoral efficacy of the bcl-2 antisense G3139 and chemotherapy in a human melanoma xenograft" pot
Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx
... K A S Q KfK aKK NKH1.2 a- pSTAAAaKAKKA RaK pSS auK aK fK aKK NaKH1.3 a- STAAPaK pTKKK RaK pSS auK aK fK a KK NaKH1.4 a- STAAPaK pTKKA RaK pSS auK aK fK aKK NaKH1.5 a- pST A E P aK pSKKK RK TSaK ... dNKH103 a- A pTAAPA AK A K A K ATK KK 2m ⁄ fK 2mK dNKH11L a- STAPAA AK A K A K AT K KK 2m ⁄ fKK dNKH11R a- ApTA – A A A aKA K A K AT K KK 2m ⁄ fKK dNKH5 a- pT pSA pS– P A – A amKR pS pST A K Q ... RMouseH1.0 a- TNpSA aK– –––K KS DSA KQK E DKH1.1 a- pS pTAASaKPaK mKA K K A pSQ K ufKK a ⁄ mKN aKH1.2 a- pSAAAAaKAKKmKR a ⁄ mK pS pSK aK ufKK a ⁄ mKN afKH1.3 a- STAAP2mK pTKKT Ra ⁄ mK pS pS ua ⁄ mK a K...
- 13
- 633
- 0
Tài liệu Báo cáo khoa học: Post-translational modification of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx
... enablesvisualization of extracellular and intracellular bacteria in the same cell [25]. The results concurred with the data from the gentamicin-based invasion assay. The ratio of intracellular ... of bacterial uptakeonce intracellular bacteria are present possibly com-bined with intracellular elimination. RhoA as well asRac1 and Cdc42 are involved in modulating cytoskele-tal rearrangements ... ismodulated by the YpkA GTPase-binding domainYpkA consists of several domains including a serine ⁄threonine kinase and a GTPase-binding domain, both of which contribute to virulence [6] (Fig. 6A) ....
- 16
- 654
- 0
Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc
... had an affinity, not for PE-containingmembranes, but rather for anionic membranes contain-ing PG [16], and little information is available regard-ing the phospholipid and membrane binding of ... membrane binding of the carboxypeptidase Yinhibitor IC, a phosphatidylethanolamine-binding proteinfamily memberJoji Mima*, Hiroaki Fukada, Mitsuru Nagayama and Mitsuyoshi UedaDivision of Applied ... group) at the logarithmic and sta-tionary phases were scored for the localiza-tion of IC–GFP at the vacuolar membrane and lumen or in the cytoplasm. Error barsindicate SE.Membrane binding of...
- 10
- 645
- 1
Tài liệu Báo cáo khoa học: Electron transfer chain reaction of the extracellular flavocytochrome cellobiose dehydrogenase from the basidiomycete Phanerochaete chrysosporium doc
... transfer chain reaction of CDH K. Igarashi et al.2872 FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS5¢-TCAGCGTTCTCGGAATTC-3¢; AP2-Xba-R, 5¢-TTTTACAGTAATATAAAGAATTTCGCTCTAGATCAAGGACCTCCCGCAAGCGCGAG-3¢; ... voltammetry wasperformed in the presence of 50 mm MgCl2using an ALSElectrochemical Analyzer 62 4A, and the potential was deter-mined by averaging the anodic and cathodic peak potentials.Presteady-state ... parameters (Km and kcat)were estimated by nonlinear fitting of the data to the Michaelis–Menten equation using deltagraph v. 5.5 (SPSSInc., Cary, NC, USA and Redrock Software, Inc., SaltLake...
- 9
- 513
- 0
Tài liệu Báo cáo khoa học: Covalent binding to glutathione of the DNA-alkylating antitumor agent, S23906-1 doc
... for a further 5 min of mild agitation, and finally 200 lLof0.1MEDTA,pH 7.5, was added and the mixture incubated for 4 h at37 °C. After addition of 80 lLof5MNaCl, the DNA wasextracted using ... and at this stage we cannot eliminate the possibility that these glutathionyl conjugates remain capable of alkylating macromolecules and thus serve as a transportform and a reservoir for the ... afterconcomitant administration of cisplatin and glutathione torats and cancer patients [39]. The primary objective of the present study was toinvestigate further the reactivity of S23906-1 towards the bionucleophiles...
- 12
- 701
- 0
Báo cáo khoa học: PRDM1/Blimp1 downregulates expression of germinal center genes LMO2 and HGAL pot
... CGTAG TG TAATG CATTTG AGATTGATCCA-3¢ and 5¢-TGGATCAATCTCAAATGCATTACACTACGAGCACGCGACCAGACTTAAAGCCTACCTTCTGTG-3¢ and for HGAL-mutant#2: 5¢-TATAAAAATTTGTACACACAGTCTTAGAGGACATACGTGTGTCGTGGCTAAATGCCTAGGAGTGAAATTGC-3¢ ... 5¢-GGAAAGAGCTCGAGTGACCAAACTGGAAACAAC-3¢ and HGAL-REV5¢-GGGAAAGCTAGCT TGTGCTCTG ACAGGGCAAC-3 ¢.PCR products were digested with SacI and NheI(New England Biolabs, Beverly, MA, USA) and ligated into the ... 5¢-TATAAAAATTTGTACACACAGTCTTAGAGGACATACGTGTGTCGTGGCTAAATGCCTAGGAGTGAAATTGC-3¢ and 5¢-GCAATTTCACTCCTA GGCATTTAGC CAC GACACACGTATGTCCTCTAAGACTGTGT GTACAAATTTTTATA-3¢.Transfections and luciferase assaysNon-Hogdkin’s lymphoma cell lines were transfected...
- 11
- 343
- 0
Báo cáo khoa học: Two overlapping antiparallel genes encoding the iron regulator DmdR1 and the Adm proteins control sidephore and antibiotic biosynthesis in Streptomyces coelicolor A3(2) pdf
... ovalbumin) and pure DmdR1 revealed using antibodiesagainst Adm (left panel) and antibodies against DmdR1 (right panel). Note the absence of Adm protein in both TAadm and DdmdR1 ⁄ adm, and the ... furtherexperiments and named TAdmdR1 (strain in whichtranslation was arrested in the sense strand of dmdR1) and TAadm (strain in which translation of the admmRNA was arrested).To compare their morphology, ... media. The Adm proteinmay serve as an activator of desferrioxamine synthesis, and the DmdR1 ⁄ Adm ‘tandem’ proteins may act as a fine modulator system of iron regulation. As indicatedabove, the...
- 14
- 435
- 0
Báo cáo khoa học: Adenine nucleotides inhibit proliferation of the human lung adenocarcinoma cell line LXF-289 by activation of nuclear factor jB1 and mitogen-activated protein kinase pathways doc
... mitogen-acti-vated ⁄ extracellular signal-regulated protein kinase path-way and the Akt pathway. Cancer 104, 879–890.26 Takada Y, Bhardwaj A, Potdar P & Aggarwal BB(2004) Nonsteroidal anti -in ammatory ... Recent advances indi-cate a number of links between the activation of p38kinase and the DNA checkpoint pathways and theirpossible interaction in the modulation of cell cycle con-trol and DNA mismatch ... Curcumin-induced antiproliferative and proapop-totic effects in melanoma cells are associated with sup-pression of IkappaB kinase and nuclear factor kappaBactivity and are independent of the B-Raf ⁄ mitogen-acti-vated...
- 12
- 403
- 0
Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx
... databases that would beindicative of a PMLA synthetase. Quantitative PCRrevealed that polymalatase mRNA was expressed atconsiderably lower levels in amoebae and spherulesthan in plasmodia. ... dsRNA.Decreased levels of PMLA after microinjection of dsRNAPMLA was measured in the extracts of the aboveNKA48-dsRNA injected and control macroplasmodiaharvested 24 h after microinjection and ... glycines,serines, and aromatics that are conserved in a bc-crystallin fold. The residues shown in grey indicate the side chains and backbone sites thatare involved in calcium binding [24]. The...
- 10
- 639
- 0
Báo cáo khoa học: Functionally active fusion protein of the novel composite cytokine CLC/soluble CNTF receptor pdf
... Murakami, M ., Hibi, M., Nakagawa, N., Nakagawa, T.,Yasukawa,K.,Yamanishi,K.,Taga,T.&Kishimoto,T.(1993)IL-6-induced homodimerization of gp130 and associated a ctiva-tion of a tyrosine kinase. ... GRAB2/Sosadaptators and regulate the MAP kinase pathway [54–56].ERK1 and ERK2, involved in the MAP kinase pathway,have been shown to play important roles in mediating the Fig. 4. Proliferation of the ... of CC–FP: the immunoglobulin-like domain and the two cytokinebinding domains of CN TFR are link ed to the four h elices of CLC by a loop containing the glycine linker (cyan). The putative binding...
- 10
- 523
- 0
Từ khóa: báo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcbáo cáo sinh học phân tửBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam