báo cáo hóa học: " The Dutch version of the knee injury and osteoarthritis outcome score: A validation study" pdf
Báo cáo y học: "Spindle Cell Lipoma of the Hypopharynx"
... the under-standing and diagnosis of benign non-epithelial endolaryngeal tumours. In connection with a case of chondroma, one of lipo-ma and one of rhabdomyoma. Acta Otorhinolaryngol Belg 1983; ... feeling of a mass in the throat without dysphagia was the only symptom of large pyriform sinus lipoma. Although the mass may be asymptomatic, it should be surgically removed, and undergo a detailed ... site and clinical incidence of lipo-ma. Factors in the differential diagnosis of lipoma and sarcoma. Acta Orthop Scand 1983; 54: 929-934. 2. Erzinger FM, Harvey DA. Spindle cell lipoma. Cancer...
- 3
- 479
- 0
Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt
... proteins, and the (Gal)5-TATA lucifer-ase reporter (A) , or the (Gal)5-SV40 reporter (B). Luciferase activity was assayed after 48 h, and is presented as the mean + standard devia-tion of duplicate ... intramolecular interactions, allowingaccess to the AD. As the autoinhibition affected anunrelated AD when this was put in place of the nativeMeis2d AD, it appears that any intramolecular interac-tions ... binding site and a minimal TATA element. Meis2d(DAD) encodes amino acids 2–345 of Meis2, and so lacks the AD, and the R332M mutant has a point muta-tion in the HD that prevents binding to a consensus...
- 14
- 753
- 0
Tài liệu Báo cáo khoa học: Substrate specificity of the pseudouridine synthase RluD in Escherichia coli doc
... Pwopolymerase (Roche Diagnostics GmbH, Mannheim, Ger-many) and primers rluD114::cat(pKD3) 5¢ (5¢-GCT ACAATA GCA CAC TAT ATT AAA CGG CAA AGC CGTAAA ACC CCG TGT AGG CTG GAG CTG CTT CG-3¢) and rluD114::cat(pKD3) ... rluD114::cat(pKD3) 3¢ (5¢-GAC CAG ATT AATGTG AAA AGA AAA TCA CGC GTA CCG GAT CGTCTT GAT GGG AAT TAG CCA TGG TCC-3¢) (comple-mentary regions to the rluD-flanking regions are under-lined). The resulting ... occurs autonomously of each other and is independent of modification at 1915.Additional 23S rRNA variants were analyzedregarding RluD specificity. Mutations A1 912C, A1 913G, C191 4A, A1 916C, A1 918G and...
- 8
- 596
- 0
Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx
... molecule, and individual mutations drasticallyreduced the activity. Because Ala lacks the character-istic side chains of Glu and Arg, the mutant recep-tors are devoid of the functional groups at the particular ... noteworthy that the inverse agonist activ-ity of 4-OHT and the inverse antagonist activity of BPA are observed for both (275Ala)-ERRc and (316Ala)-ERRc mutant receptors, and even for (Ala,Ala)-ERRc.DiscussionDifferential ... and the inverse antagonist activity of BPA (1 and 10 lM) against the inverse agonist activity of 4-OHT (1 and 10 lM). The assay set marked with an asterisk shows the the inverse antagonistactivity...
- 12
- 583
- 0
Tài liệu Báo cáo khoa học: N-terminal extension of the yeast IA3 aspartic proteinase inhibitor relaxes the strict intrinsic selectivity ppt
... GGAATTCCATATGAGTGATAAAAACGCTAACGTC(R) CTAGCTAGCCATGTTTTTCATTCCTTCACTAGC11 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT(R) CCGCTCGAGCGGCTATCTATCTAATGATCCATCAATTCATCTTTATC12 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT(R) ... GGAATTCCATATGCAGAATACAGACCAACAAAAAGTGAG(R) CCGCTCGAGCGGCTATCTATCTACTCCTTCTTATGCCCCGCCnewpetTOP CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATAAGCTTATGAAACACCACCACCACCACCACCAnewpetBOT TATGGTGGTGGTGGTGGTGGTGTTTCATAAGCTTATCTCCTTCTTAAAGTTAAACAAAATTATTTT. ... GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT(R) CCGCTCGAGCGGCTATCTATCTATTGTTCTTGCTTCCCAGCACC13 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT(R) CCGCTCGAGCGGCTATCTATCTAATACGAATCTTGAGCTTTCTTTTC14 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT(R)...
- 10
- 510
- 0
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx
... evaluate the contribution of K88 and K13 to protein stabilization in the reaction with sul-fate. The far-UV and Soret CD spectra of the twomutants (not shown) reveal that the two variants and the ... observed may indicate that the variants undergo very fast optical (and thus structural)changes within the dead time of the stopped-flowapparatus. In the case of the K13N mutant, this hypo-thesis ... T89K and K13N mutations lead to stabilization, in the absence of sulfate, of the misligated bis-H LS (IHH) A- state (although to a different extent for the lastmutant). The addition of sulfate...
- 11
- 487
- 0
Tài liệu Báo cáo khoa học: Co-operative effect of the isoforms of type III antifreeze protein expressed in Notched-fin eelpout, Zoarces elongatus Kner ppt
... crystal in the finalstate. This hypothesis is comparable to that of Bur-cham et al. [31]. They assumed that stabilization of the antifreeze action of small (weak) species of AFGP(AFGP6-8) by large ... cDNA consisting of 500 bp purified from the cDNA library using the templates of Ex-Taq DNA polymerase (TaKaRa), oligo-dT linkerprimer (5¢-GAGAGAACTAGTCTCGAGTTT-3¢), and the synthetic primer of the ... clearconcentration dependence on, the addition of a smallamount of a QAE1 isoform, nfeAFP8 (Fig. 7). This issimilar to the case of the QAE2 isoform, nfeAFP13; the activity of its monomer was enhanced...
- 11
- 696
- 0
Tài liệu Báo cáo khoa học: "On Learning Subtypes of the Part-Whole Relation: Do Not Mix your Seeds" pdf
... Keet and Artale, 2008). The taxonomy of Keet and Ar-tale (2008), for instance, distinguishes part-wholerelations based on their transitivity, and on the semantic classes of entities they sub-categorize.Part-whole ... (member -of, sub-quantity -of, contained-in, structural part -of and located-in), and for the general set composed of all types.4.1 Precision of Extracted RelationsTwo human judges manually evaluated ... comparing the results of these three sets among themselves, and with the results of the member -of and contained-in seeds, indicating insignificant similarity and overlap. Examining the patterns harvested...
- 9
- 622
- 0
Tài liệu Báo cáo Y học: NMR-based determination of the binding epitope and conformational analysis of MUC-1 glycopeptides and peptides bound to the breast cancer-selective monoclonal antibody SM3 pptx
... epitope. The extracellular part of the epithelial glycoprotein MUC-1consists of tandem repeats of 20 amino acids(PDTRPAPGSTAPPAHGVTSA, where the start of the tandem repeat peptide sequence varies. ... ecrystalcellthathaveadistanceof 4A ˚or less to the ligand. The C-terminal part of the pe ptide (RPAP) has clo se contacts to the n ext protein in the crystal cell and is therefore stabilized on the surface ... scan tominimize temperature and magnet instability artefacts. The so called on resonance irradiation of the protein wasperformed at a chemical shift of )2 ppm. Off resonanceirradiation was applied...
- 12
- 717
- 0
Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx
... obtainedfor the glutaminase reaction in the presence of 0.1 mMeach of UTP and ATP-cS (data not shown). Apparently, the value of K a , kcat,1 and kcat,2were similar regardless of the active ... 4-phosphorylated UTP intermediate in a mechanism asthat of Scheme 1A. From Fig. 4 and Table 2 it can be seen that the effect of saturating the active site with ATP-cS and UTP was a relief of partial ... in the presence of GTP, UTP and the nonhydrolyzable ATPanalog ADPNP [8]. Furthermore, it was shown that the fold activation of the glutaminase activity by GTP wassimilar to that of the overall...
- 8
- 698
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròbáo cáo giáo dục thể chất trường tiểu họctrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học ảnh hưởng của việc thay thế cỏ xanh trong khẩu phần bằng bã dứa ủ chua đến khả năng sản xuất của bò thịt pottài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdfbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caolam the nao de tom tat bao cáo khoa hocbai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ