báo cáo hóa học: "Impact of chronic Immune Thrombocytopenic Purpura (ITP) on health-related quality of life: a conceptual model starting with the patient perspective" potx
Báo cáo y học: "Impact of the Kenya post-election crisis on clinic attendance and medication adherence for HIV-infected children in western Kenya"
... for the AMPATH research network. He is also the Pediatrician-In-Charge for the AMPATH Pediatric HIV Care Program and the Neonatal Unit of Moi Teaching and Referral Hospital.ES is a Data Manager ... participated in the acquisition of data andqualitative analyses. He revised the manuscript criticallyand gave final approval for publication. ES and BM organ-ized the study data, contributed to the ... affected. They further noted that the quantitativedata did not adequately capture the bravery of the AMPATH patients or the AMPATH staff. The intervieweesemphasized the heightened vulnerability of...
- 10
- 696
- 0
Báo cáo khoa học: "Impact of computerized physician order entry on medication prescription errors in the intensive care unit: a controlled cross-sectional trial"
... the study. KC wasresponsible for conceiving the study, data acquisition, analysis of the data, statistical analysis and drafting of the manuscript.BC was responsible for data acquisition, analysis ... in the patient charts. The study, however, was conducted four weeks after anupgrade with installation of the allergy notification, and a recent evaluation showed a more adequate registration. ... unaware of the ongoing study. As itwas not possible to screen every patient on a daily basisbecause of lack of time, patients were picked with a minimalpause of one day between selections. All...
- 9
- 738
- 1
Tài liệu Báo cáo khoa học: Impact of the native-state stability of human lysozyme variants on protein secretion by Pichia pastoris doc
... that the native states of all four of the mutationalvariants of human lysozyme that are known to belinked with disease are destabilized to a remarkablysimilar extent, and all have dramatically ... D67H, the F57I andW64R variants clearly populate partially folded inter-mediates upon thermal denaturation, and the values of the midpoints of thermal denaturation are significantlylower than ... cell lysate samples of the W64R variant.Comparison of mRNA levels The total RNA content of the P. pastoris strains containingeach lysozyme variant gene was isolated using a QiagenRNeasy Mini...
- 10
- 577
- 0
Báo cáo khoa học: Impact of cyclic hypoxia on HIF-1a regulation in endothelial cells – new insights for anti-tumor treatments doc
... the PI3K ⁄ Akt pathway and the cell respiration rate lead to an increasein HIF- 1a stabilization, thereby promoting endothelial cell survival.These effects are partly attenuated by the concomitant ... O2consumption) and the concomitant activation of Aktconcur to support the accumulation of HIF- 1a duringCyH. Of note, in the immunoblotting data correspondingto the various hypoxic and reoxygenation phases, ... endothe-lial cell respiration as a secondary mechanism drivenby cyclic hypoxia and promoting HIF- 1a accumula-tion. The decrease in intracellular O2bioavailabilityparallels the progressive accumulation...
- 10
- 522
- 0
Báo cáo khoa học: "Impact of Initiative on Collaborative Problem Solving ∗" docx
... potentially there there is a relation be-tween these participation correlations and initiative.An analysis of initiative shows that there is a cor-relation of initiative and successful collaboration. ... characterized as a finite state ma-chine with a stack and a student model. To imple-ment the peer agent, I will replace TuTalk’s student model and add a planner module.Managing the information ... 2006). TuTalk contains a core set of dialoguesystem modules that can be replaced or enhanced asrequired by the application. The core modules areunderstanding and generation, a dialogue managerwhich...
- 6
- 397
- 1
Báo cáo y học: "Relationships between free radical levels during carotid endarterectomy and markers of arteriosclerotic disease"
... combination of all variables analysed. Each subsequent component con-stitutes an independent linear combination of vari-ables, capturing a maximum of the variance remaining in the data set, and ... principal component analysis (PCA) was performed on the total data set. All variables were scaled to zero mean and unit variance. A detailed description of the computational steps involved in a ... regression between X- and Y-data in addition to producing a compact representation of the data. In the calculation of principal components, the components of the X-block that produce the strongest...
- 7
- 640
- 0
Báo cáo y học: "Hepatitis C Virus Serologic and Virologic Tests and Clinical Diagnosis of HCVRelated Liver Disease"
... currently an Associate Editor of Hepatology, the official journal of the American Association for the Study of Liver Diseases (AASLD), and of Current Hepatitis Reports, and a member of the Editorial ... dynamic ranges of quantification of the currently available assays, i.e. the HCV RNA intervals within which quantification is accurate in the corresponding assay. HCV RNA levels falling above ... exacerbation of chronic hepatitis C or an acute hepatitis of another cause in a patient with chronic hepatitis C. Acute hepatitis C is very unlikely if both anti-HCV antibodies and HCV RNA are...
- 6
- 612
- 0
Báo cáo y học: "Postoperative pain scores and analgesic requirements after thyroid surgery: Comparison of three intraoperative opioid regimens"
... mg/kg. Tracheal intubation was performed without muscle relaxant, and anesthesia was maintained with isoflurane (end tidal 0.7-1%) and N2O/O2(50/50). Analgesia was started with a bolus fentanyl ... 0.05). Conclusion: After remifentanil based analgesia, anticipation of postoperative pain with opioid analgesic appears mandatory even for surgery rated as being moderately painful, otherwise longer ... patient was excluded from the study and additional patients were enrolled. After the dissection of the first thyroid lobe, all patients received 1g of paracetamol and 20 mg nefopam IV as part of...
- 3
- 516
- 1
Tài liệu Báo cáo khoa học: Secondary substrate binding strongly affects activity and binding affinity of Bacillus subtilis and Aspergillus niger GH11 xylanases docx
... of carbohydrate-active enzymes have revealed the presence of othersubstrate binding regions situated on the surface of the structural unit that contains the catalytic site, ratherthan on an ... aftersubtraction of the control value (no enzyme) under the con-ditions of the assay.Activity on Azo-wheat AXAn appropriate enzyme dilution and liquid Azo-wheat AXsubstrate were pre-incubated separately ... SBS. Mutational analysis demonstrated that theseSBS residues are important for the activity on starchand that they play a role in the binding of the enzymeto bacteria of the oral cavity [15]....
- 14
- 600
- 0
Tài liệu Báo cáo khoa học: Hsp105b upregulates hsp70 gene expression through signal transducer and activator of transcription-3 pdf
... 5¢-TCT ATC TCT CGA TGGATA CAG A- 3¢; reverse, 5¢-AGG ACA GTA GAA TTAGGT CAC T-3¢).Knockdown of Hsp10 5a and Hsp105b The double-stranded RNA targeting Hsp105 (Dharmacon;5¢-GCA AAU CAC UCA UGC AAA ... GGGTTATGTTAGCTCAGTTACAGTApGL70()218) Sense TGTCCCCTCCAGTGAATCCCAGAAntisense GGGTTATGTTAGCTCAGTTACAGTApGL70()194) Sense ACTCTGGAGAGTTCTGAGCAGAntisense GGGTTATGTTAGCTCAGTTACAGTAMechanism of Hsp105b-induced ... Stephanou A, Isenberg DA, Nakajima K & LatchmanDS (1999) Signal transducer and activator of transcrip-tion-1 and heat shock factor-1 interact and activate the transcription of the Hsp-70 and...
- 11
- 584
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròbáo cáo khoa họcbáo cáo y họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM