Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx

... 9:36http://www.translational-medicine.com/content/9/1/36Page 4 of 14 Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virusHaddad et al.Haddad ... Open Access Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virusDana Haddad1,2†, Nanhai ... article as: Haddad et al.: Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus. Journal of...

báo cáo hóa học:" Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" potx

... 9:36http://www.translational-medicine.com/content/9/1/36Page 3 of 14 Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virusHaddad et al.Haddad ... RESEARC H Open Access Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virusDana Haddad1,2†, ... article as: Haddad et al.: Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus. Journal of...

Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt

... oli-gonucleotides: For the NL4-3 vpu TM region, NL-TM-F,CATGGAGATGCAACCTATAATAGTAGCAATAGTAG-CATT AGTAGTAGCAATAATAATAGCAATAGCTGTGT-GGTCCATAGTAATCATAGAATAGG and NL-TM-R,AATTCCTATTCTATGATTACTATGGACCACACAGCTATTGCTATTATTATTGCTACTACTAATGCTACTATTGCTAC-TATTATAGGTTGCATCTC; ... NL-TM-R,AATTCCTATTCTATGATTACTATGGACCACACAGCTATTGCTATTATTATTGCTACTACTAATGCTACTATTGCTAC-TATTATAGGTTGCATCTC; for the R5 vpu TM region, R5-TM-F,CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGGAGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGT-GGACCATAGTATATATAGAATAGG ... R5-TM-F,CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGGAGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGT-GGACCATAGTATATATAGAATAGG and R5-TM-R, AATTCCTATTCTATATATACTATGGTCCACACGACTATT-GCTATGATTAGTGCTA CTATCAATGCTCCTACTC-CTAATTTATAATCTAAATTTAACATCTC. The cytoplasmicdomains were PCR amplified using...

Báo cáo sinh học: "Analysis of the human cytomegalovirus genomic region from UL146 through UL147A reveals sequence hypervariability, genotypic stability, and overlapping transcripts" ppt

... used for UL132: 5'-TACACCCT-GTCACCGAA AGC-3' (forward); 5'-CTGATCGCGG-TAGTTTACTC-3' (forward); and 5'-TCACGAACGACGTGTCCAAG-3' (reverse).Northern analysisNorthern ... used for the Portland specimens for the same regionwere 5'-GCTTAAGCCAATCGCAGCGAGC-3' and 5'-GTCGCCTCGGTAGCTCAGTAGC-3'. The amplification proto-cols were the same as described ... conceived the study, analyzed the data from the Chi-cago site, and drafted the manuscript. SC contributed to the design of the study, analyzed the data from the Port-land site, and helped to draft the...

Báo cáo khoa học: Disruption of the gene encoding 3b-hydroxysterol D14-reductase (Tm7sf2) in mice does not impair cholesterol biosynthesis pdf

... Sdc4:forward, 5¢-GCGGCTCGGATGACTTTG-3¢; reverse, 5¢-AAGGGCTCAATCACTTCAGG-3¢. Cib3: forward, 5¢-ATGACTTCAACAATGACAACTAC-3¢; reverse, 5¢-ATCCAGCACCTTCTCACAG-3¢. Cyp 4a1 0 ⁄ 31: forward, 5¢-GCCTCTGTGCTCGGTCTG-3¢; ... 5¢-AGCCTTGAGTAGCCATTGCC-3¢. Cyp2c39: forward 5¢-TGCTCTCCTACTCCTGATGAAG-3¢; reverse, 5¢-GGGCATGTGGTTCCTGTCC-3¢. Cdc20: forward, 5¢-GCAACAGGAGGAGGAACCAG-3¢; reverse, 5¢-CATCCACAGCACTCAGACAGG-3¢. ... Cdkn 1a: forward, 5¢-AAAGTGTGCCGTTGTCTC-3¢;reverse, 5¢-AAAGTTCCACCGTTCTCG-3¢. Accn5: for-ward, 5¢-GGTGACCATCCGCCAACTG-3¢; reverse, 5¢-CCGTAAGTGCTGTAGGTAATGAAG-3¢. Onecut1: forward,5¢-CCTCTATGAATAACCTCTATACC-3¢;...

Tài liệu Báo cáo khoa học: Roles of the human Rad51 L1 and L2 loops in DNA binding doc

... increase the sig-nal to noise ratio. All of the spectra were corrected for the Raman signal and background by subtracting the spectrum of the buffer.ATPase activityRad51 (5 lm) or a Rad51 mutant ... 2F) of the puriﬁed Rad51-F27 9A were allsimilar to those of HsRad51, indicating that the muta-tion did not affect the global structure, the polymerformation, and the ATPase activity. The mutation ... (jm)nicked circular DNA (nc)ssDNAdsDNAjmnc A BFig. 4. The strand-exchange activities of the Rad51 mutants. (A) A schematic diagram of the strand-exchange assay. (B) The Rad51 concen-trations were...

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

... under-lined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined),then a secondary amplification with primers 5¢-CACCACCACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢(His-tag underlined) ... underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tagunderlined) and 5¢-GCGGCATGCTCATCCAAAGAAGCTTGGGTCG-3¢. The two amplified fragments were usedas a combined template for the ... PSI-G or tagged PSI-G into thylakoids. Shown arefluorograms of the fractions obtained fromimport of radioactive precursors intoisolated, intact pea chloroplasts. The lanescorrespond to: in...

Báo cáo khoa học: Regulation of the human leukocyte-derived arginine aminopeptidase/endoplasmic reticulum-aminopeptidase 2 gene by interferon-c pot

... Compilation of vertebrate-encoded transcription factors. Nucleic Acids Res 20,3–26.31 Taniguchi T, Ogasawara K, Takaoka A & Tanaka N(2001) IRF family of transcription factors as regulators of ... from )88 to )68)for phLP3; CGGGTACCTACTCAGGAAGCATGCAAGT (sense strand of the sequence from )67 to )47)for phLP4; CGGGTACCACAGAAAGTGAAAGCA(sense strand of the sequence from )33 to )18) forphLP5; ... luciferase assay system (Promega) accord-ing to the manufacturer’s instruction. Luciferase activitywas measured in triplicate, averaged, and then normalized to b-galactosidase activity to correct for...

Báo cáo khoa học: Internalization of the human CRF receptor 1 is independent of classical phosphorylation sites and of b-arrestin 1 recruitment potx

... used the CRFanalogue125I-labelled sauvagine for i nternalization studies. The use of radioligand internalization to assay receptorinternalization is based on the assumption that receptor andligand ... for a more profound translocation of b-arrestin1 to the receptor.Interestingly, removal of putative phosphorylation sites in the C-terminal tail and /or IC3 did not alter the extent of receptor ... thisreceptor. The effect of PKA and PKC was investigated by use of the speciﬁc PKA inhibitor H-89 and the broad-spectrumprotein kinase inhibitor stauroporine. Radioligand inter-nalization assay was performed...

báo cáo sinh học:" Review of the utilization of HEEPF – competitive projects for educational enhancement in the Egyptian medical sector" potx

... lack of a sustainable financial policy,inadequate infrastructure, under-trained faculty membersin some areas, poor instructional materials and equip-ment and lack of a formal evaluation and ... mainly in the medicine specialty of the medicalsector (8.9%)Although QAAP is one of the six projects of the HEEP,8.9% of the medical sector projects of the HEEPFaddressed the area of quality ... solelyon the total score of the secondary school graduation cer-tificate. Applicants for medical sector colleges always have the highest marks among high school graduates, as thesecolleges admit...

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam