báo cáo hóa học: " Dental pain, oral impacts and perceived need for dental treatment in Tanzanian school students: a cross-sectional study" docx

... CentralPage 1 of 9(page number not for citation purposes)Health and Quality of Life OutcomesOpen AccessResearch Dental pain, oral impacts and perceived need for dental treatment in Tanzanian ... untreated dental caries, oral impacts ondaily performances and perceived need for dental care. Dental pain and reported oral problems variedsystematically with OIDP across the eight impacts ... dental pain and dental problems. Table showing the oral impacts on daily performances by socio-demographics, dental caries, den-tal pain and dental problems. In this table a Adjusted for age,...

báo cáo hóa học:" Dental pain, oral impacts and perceived need for dental treatment in Tanzanian school students: a cross-sectional study" pptx

... dental pain and dental problems. Table showing the oral impacts on daily performances by socio-demographics, dental caries, den-tal pain and dental problems. In this table a Adjusted for age, ... be a reliable and valid instrument when applied to children in numer-ous countries, such as Thailand, France, UK and Tanzania[5-8].Untreated dental caries might lead to dental pain and impact ... primary school in Kilwa dis-trict, Tanzania, detailed the association of clinical- and self-reported oral health indicators with OIDP and exam-ined which oral impacts on daily activities affected...

báo cáo hóa học: "Effect of step-synchronized vibration stimulation of soles on gait in Parkinson''''s disease: a pilot study" doc

... caused by a dopamine defi-ciency in the basal ganglia that results in characteristicmotor abnormalities including postural instability and gait impairment. Short shuffling steps, slow walkingspeed, ... walkingspeed, and increased stride variability characterize abnor-mal gait in PD. Although PD is primarily a motor disease,accumulating evidence suggests that abnormal proprio-ception and kinesthesia ... studies showed that stim-ulation of the metacarpal joints activated ipsilateral sen-sory cortical areas and contralateral basal ganglia [32].Results of this study, however, may be not applied to...

báo cáo hóa học:" Synthetic lethal RNAi screening identifies sensitizing targets for gemcitabine therapy in pancreatic cancer" doc

... sequenceswere as follows: CHK1 -A, AAGAAAGAGATCTGTATCAAT;CHK1-B, TTGGAATAACTCCACGGGATA; CHK1-C,AACTGAAGAAGCAGTCGCAAGT; CHK1-D, CCCG-Journal of Translational Medicine 2009, 7:43 http://www.translational-medicine.com/content/7/1/43Page ... ACGCCGTCCTTT-GAATAACAA; CHK2-B, AGGACTGTCTTATAAAGATTA;CHK2-C, CAGGATGGATTTGCCAATCTT; and CHK2-D,CTCCGTGGTTTGAACACGAAA. The sequences used in HT-RNAi screening were the A and B sequences for bothCHK1 and CHK2.Synthetic ... screening was per-formed by IMG and MCH and analyzed by SA, JAK and AC. Functional validation of siRNA sensitization and drugsynergy was performed by IMG. KMB, GDB and SA per-formed the validation...

báo cáo hóa học: " Health-related quality of life of patients following selected types of lumbar spinal surgery: A pilot study" ppt

... healing.Symptoms: pain and moodThe primary complaints of patients undergoing lumbarspinal surgery are back pain and radicular pain accompa-nied by leg weakness. The goal of spinal surgery is to ... reliabilities may be low due to a change in thepatients' health after surgery as well as a three-monthperiod between test administrations.Data analysisData was entered into the statistical analysis ... status in this study. The Numeric Pain Rating Scale(NPRS) was used to measure degree of pain on a scale of0 to 10 with 0 being no pain and 10 being extreme pain.Pain decreased from a mean...

báo cáo hóa học: " Comparing the SF-12 and SF-36 health status questionnaires in patients with and without obesity" pot

... study, analyzed and interpreted the data and drafted the manuscript. RD and MBH contributed to the design and interpretation ofthe analysis. All authors read and critically revised and approved ... response to individual items comprising that subscale;the subscales are then standardized using a z-score trans-formation and aggregated to estimate the aggregatedphysical and mental summary scores. ... comprising eightsubscales – physical functioning, role functioning (physi-cal and emotional), bodily pain, general health, vitality,social functioning, and mental health. Using standardmethods...

Báo cáo hóa học: "The toxicity of cadmium and resulting hazards for human health" ppt

... hyperkeratosis and acanthosis with occasionalulcerative change, and an increase of the mitotic index ofthe skin cells. Also cadmium concentration in blood, liver and kidney increased, thus indicating ... μgcadmium; 95% of this taken up with food and drinks. Anaverage smoker has an additional intake of 30 μg per day[4]. Several factors can increase this amount, such as lowintakes of vitamin ... human gastrointestinal is approx-imately 5% of an ingested amount of cadmium, depend-ing on the exact dose and nutritional composition [3]. Anaverage German citizen has a daily intake of 30–35...

Báo cáo hóa học: " Quantitative profiling of housekeeping and Epstein-Barr virus gene transcription in Burkitt lymphoma cell lines using an oligonucleotide microarray" docx

... AGGCCTTCCCGAGAAAGTGCTTAGCCTTGTTGATGATCCAAGGAACCACATAGAGAACCAAGACGAGTGCKIAA0220 Hs.110613 70 1121 416 82.4 60.0 CS TGGAACCATCATCACCCGAACCCAAGAGGCGGAGGGTCGGTGACGTGGAACCGTCACGCAAACCCAAGAGCLU Hs.75106 ... CS GTAGCTGCCTGCATAGGAGCCTCGCTTCCGATTATTCCCTTCCCAATATTATTCATCCAGACTTAGCCACKARS Hs.3100 70 1997 142 73.6 38.6 CS GCAACCACTGATACACTGGAAAGCACAACAGTTGGCACTTCTGTCTAGAAAATAATAATTGCAAGTTGTAAAMP Hs.83347 ... 44.3 CS TATCTTCGGAAGAACCCCAATTATGATCTCTAAGTGACCACCAGGGGCTCTGAACTGTAGCTGATGTTATPSMB3 Hs.82793 70 692 42 79.4 52.8 CS ATCATCGAGAAGGACAAAATCACCACCAGGACACTGAAGGCCCGAATGGACTAACCCTGTTCCCAGAGCCT CFL1...

báo cáo hóa học:"Special theme on HIV and disability - time for closer bonds" pdf

... dismay-ing lack of adequate efforts in this area, some positivedevelopments have been made. As an example, at the lat-est International AIDS Conference, held in Mexico City in August 2008, several sessions ... PubMed and archived on PubMed Central yours — you keep the copyrightSubmit your manuscript here:http://www.biomedcentral.com/info/publishing_adv.aspBioMedcentralJournal of the International AIDS ... http://www.jiasociety.org/content/12/1/26Page 2 of 2(page number not for citation purposes)ity and equal opportunity, are among the guiding princi-ples of this convention [2].Research on HIV and disability...

báo cáo hóa học:" Response shift, recall bias and their effect on measuring change in health-related quality of life amongst older hospital patients" pdf

... review, appraisal and editing. Bothauthors read and approved the final manuscript.Author Details1Centre for Functioning, Disability and Health Research, Queensland Health, Buranda Plaza, Corner ... conventional change and patient perceived change adjusted for recall bias was also calculated for Table 1: Demographic information for participants included in analysis.Hospitalised older adults(n ... Queensland Medical Research Eth-ics Committee.Data AnalysisDemographic information including mean age, baseline and discharge health-related quality of life reports weretabulated (Table 1). Change...

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015