... sub-
strates of H
+
⁄ peptide cotransporters, such as Gly-Sar,
Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala,
d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide
(all 100 lm, Table 1). Glycine, ... JC, Fujita T, Liang R, Ganapathy V & Lei-
bach FH (1998) Identification of a potential substrate
binding domain in the mammalian peptide transporters
PEPT1 and PEPT2 using P...
... follows:
forward primer, GTT GGA ATT CCA TCA TCA TCA
TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and
reverse primer, GAT CGG TAC CTC ATT ACA GAG
GAG GGA TAT GGG GAA C. The PCR reaction was
done as described above. ... tyrosinase was also
inactivated completely within 20 min [40]. In general,
mammalian and plant-derived tyrosinases are not very
thermostable; even a short incubation at 70–...
... defined as a set of syntactic and
semantic features shared by one or several
morpho-syntactic elements. Roughly speaking, it
contains the kind of information one expect to
find in a standard ...
INTRODUCTION
It has been traditionally assumed by
computational linguists and particularly by
designers of large natural language processing
systems such as machine translatio...
... 5¢- and 3¢-UTR are underlined and the 13 repeats with a consensus of
CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR are numbered and distinguished from each other by alternate highlighting
in ... and an insertion of 12 repeats with a consensus
of CCAATGATGATCCAAGAAATCCACACTACAG
(31 bp) in the 3¢-UTR of the cDNA sequence (Fig. 1).
A TATA box was identified...
... (5¢-GGCCAAGCTTCTAGAAC
TTGAGAACCCTAGC-3¢) (for the P. horikoshii CoADR),
and TG104 (5¢-CGCGCCATGGAAAAGAAAAAGGTA
GTCATAA-3¢) and TG105 (5¢-CGCGGTCGACCTAGAA
CTTCAAAACCCTGGC-3¢) for the P. furiosus CoADR.
The N terminus of ... to act as an NADH oxidase in vivo, instead act-
ing as a CoADR. This is only the second demonstra-
ted CoA reductase activity, and the first appearance of
this...
...
provement in parsing accuracy.
Sample mappings from the terminals and non-
terminals of our grammar to those of the Lancaster tree-
bank are provided in Table 5. For ease of understanding,
we ... hand, and have thus experi-
mented with only a small number of paramcterizations.
Constrained training: The Inside-Outside algo-
rithm is a special case of the general...
... identity
with the BAS1 protein of Brassica, spinach, barley and
A. thaliana,PR1ofPhaseolus and MHF
9
of A. thaliana.
These proteins b elong to the 2Cys-Prx subfamily. A ll plan t
2Cys-Prx proteins, ... Mare
Â
chal, P.,
Miginiac-Maslow, M. & Meyer, Y. (1994) Arabidopsis thaliana
NADPH thioredoxin reductase: cDNA characterization and
expression of the r e combinant protein...
... (5¢-GCGCG
GGATCCTCATTTAAGCAT
GAAAACAACTTTGCC, antisense), containing NcoI and
BamHI sites (underlined in the sequences). In order to
introduce an NcoI restriction site, an extra alanine codon
(GCA) was introduced ... was transformed
with pWUR78 and a single colony was used to inoculate
5 mL Luria–Bertani medium with kanamycin and spectino-
mycin (both 50 lgÆml
)1
) and incub...
... application of
JA. These experiments demonstrate that individual mem-
bers of the jasmonate family are involved – at least in
Arabidopsis – in different signalling pathways.
An Arabidopsis(jar1)mutantwithadefectinthe
jasmonate ... t hey
are capable of mediating a response by regulating gene
expression [6,7]. Analysis of Arabidopsis thaliana mutants
impaired in either JA biosyn...