Báo cáo sinh học: " Reduced expression of Jak-1 and Tyk-2 proteins leads to interferon resistance in Hepatitis C virus " docx
Báo cáo sinh học: " Reduced expression of Jak-1 and Tyk-2 proteins leads to interferon resistance in Hepatitis C virus " docx
... exposed to HCV slowly develop into chronic infec-tion. Long-standing chronic inflammation in the liver due to the virus infection leads to liver cirrhosis and carci-noma [1-7]. Infection with HCV ... for reduced inter-feron signaling in these replicon cells, expression of Jak-Stat proteins of interferon was examined. Interferon sign-aling occurs through a series of protein-protein interac-tions ... cellularcontribution in the mechanism of IFN -resistance, HCVreplication was eliminated from each cell line by treat-ment with Cyclosporine-A. The success of Cyclosporine-Atreatment and absence of HCV RNA in...
- 13
- 305
- 0
Báo cáo sinh học: " Persistent expression of chemokine and chemokine receptor RNAs at primary and latent sites of herpes simplex virus 1 infection" pptx
... CTCTGTCACCTGCATGGCCTGGTCTCCR3ACCAGCTGTGAGCAGAGTAAACAT CACAGCAGTGGGTGTAGGCA CACCTCAGTCACCTGCATGGCCACCR5ACTGCTGCCTAAACCCTGTCA GTTTTCGGAAGAACACTGAGAGATAA TCCGGAACTTCTCTCCAACAAAGGCACCR6TTGGTGCAGGCCCAGAAC GAACACGAGAACCACAGCGAT CCAAGAGGCACAGAGCCATCCGACCR7CTGCTACCTCATTATCATCCGTACCT ... CTCTGACCCTCCCACTTCCTGCTGTTTRANTESCTGTCATCGCTTGCTCTAGTCCTA CGGATGGAGATGCCGATTT ATCCCCTACTCCCACTCCGGTCCTGMCP-1GCTGGGTTCAGTTTCCTTAAGC CCTAGTCTTTAGCTGTGAGACCTTCTG AGGCCTCGCTGCTCCACATCCAEotaxin-1CCTAAGACGTGCTCTGAGGGAAT ... CCAAGAGGCACAGAGCCATCCGACCR7CTGCTACCTCATTATCATCCGTACCT TGATCACCTTGATGGCCTTGT CTCCAGGCACGCAACTTTGAGCGCXCR3TGTAGTTGGGCTAGCTCGAACTT ACCTGGATATATGCTGAGCTGTCA GCATCCTGGCAGCAAAGTTACGGGCXCR4CTCCAAGGGCCACCAGAA GGCAAAGAAAGCTAGGATGAGG...
- 12
- 307
- 0
Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf
... from the cytosolic fraction. Proteins in the cytosolicfraction were precipitated with cold acetone (1 : 1, v ⁄ v) for60 min at )20 C and centrifuged at 13 000 g for 30 min at4 C. The pellet ... (1988)Improved staining of proteins in polyacrylamide gelsincluding isoelectric focusing gels with clear backgroundat nanogram sensitivity using Coomassie Brilliant BlueG-250 and R-250. Electrophoresis ... exclusive of knockout mice. Twenty of these differentially expressed proteins were correctly matched to protein candidates in the database (Table 1) according to their peptidemass fingerprints...
- 9
- 481
- 0
Báo cáo sinh học: " Differential expression of papillomavirus L1 proteins encoded by authentic and codon modified L1 genes in methylcellulose-treated mouse keratinocytes" ppt
... KCs were respectivelytransfected with 2 μg of each of the four PV L1 plasmidCell morphology and expression of involucrin in the primary mouse KCs grown in KC-SF medium containing different concen-tration ... concen-tration of methylcellulose for 2 daysFigure 1Cell morphology and expression of involucrin in the primary mouse KCs grown in KC-SF medium containing different concentration of methylcellulose ... study of HPVs in cell culture has been hindered because of the difficulty in recreating the three-dimensional structure of the epi-thelium on which the virus depends to complete its lifecycle....
- 6
- 394
- 0
Báo cáo sinh học: "Elevated expression of CDK4 in lung cancer" pptx
... Antisense:5’CGATTTCCAAAAAGCATGTAGACCAGGACCTAAGTCTCTTGAACTTAGGTCCTGGTCTACATGCGGGGA 3’) CDK4 1097 Sense:5’CGCGTCCCCGCAGCACTCTTATCTACATAATTCAAGA-GATTATGTAGATAAGAGTGCTGCTTTTTGGAAAT3’ ;Antisense:5’ CGATTTCCAAAAAGCAGCACTCT-TATCTACATAATCTCTTGAATTATGTAGATAAGAGTGCTGCGGGGA ... 0-6or7-12wasrespectivelyconsideredtobeloworhigh expression. Establishment of lung cancer A549 cell line with stablyexpressing shRNA-CDK4We selected two sequences(CDK4 509: Sense:5’CGCGTCCCCGCATGTAGACC AGGACCTAAGTT-CAAGAGACTTAGGTCCTGGTCTACATGCTTTTTG-GAAAT ... obtained. Histological clas-sification and clinicopatholo gic staging of th e sampleswere performed according to the rules of according to the WHO histologic classification.ImmunohistochemistryParaffin...
- 9
- 301
- 0
Báo cáo sinh học: "Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" pot
... International) and enhanced with SuperSignal Chemiluminescence kit(Pierce Biotechnology).Immunohistochemistry and scoring To investigate the significance of Her2 and Her3 expres-sion in HNSCC, 4-micron ... notshown). Her2 staining was scored based on the scoringsystem applied to breast cancers, with scores of 0,+1,+2, +3 for increas ing intensity and “ continuity” of stain-ing of the cell membrane[17]. ... transmembrane domain, and an intracytoplas mic tyrosine kinase domain[3-5]. Ligandbinding to these receptors induces the formation of * Correspondence: genejock@helix.nih.gov† Contributed equally1Tissue...
- 10
- 490
- 0
Báo cáo sinh học: " Constitutive expression of Atlantic salmon Mx1 protein in CHSE-214 cells confers resistance to Infectious Salmon Anaemia virus" ppt
... virulence. Vertebrates [9], including fish[10], mount an early strong innate immune responseagainst virus infections, characterized by the induction and secretion of cytokines, such as type I interferons ... to replicate and cause CPE in CHSE-214 cells [7].Total RNA was extracted from 300 µl of cell culture super-Table 1: Inhibition of ISAV NBISA01 by AsMx1 in CHSE-214 cells.CHSE-214 cells1CPE ... non-cytopathic) in the CHSE-214 cell line.We present evidence that ISAV is sensitive to ASMx1. CHSE-214 cells constitutively expressingASMx1 showed increased resistance to infection with the cytopathic...
- 6
- 318
- 0
Báo cáo khoa học: The expression of retinoblastoma and Sp1 is increased by low concentrations of cyclin-dependent kinase inhibitors ppt
... determination of mRNA levels, the primers were:5¢-CGCCAAACTTGGGGGAAGCA-3¢ and 5¢-GAACCAGGTTTTCCGGCCCA-3¢ for DHFR; 5¢-GTGCCAATGGCTGGCAGATCA-3¢ and 5¢-ACCATCCTGCTGCACTTGGGC-3¢ for Sp1; 5¢-CTCCACACACTCCAGTTAGGA-3¢ ... 5¢-CTCCACACACTCCAGTTAGGA-3¢ and 5¢-CTGATTTAAGCATGGATTCCA-3¢for Rb; and 5¢-CGCAGTTTCCCCGACTTCCC-3¢ and 5¢-GGCAGCGCACATGGTTCCTC-3¢ for adenine phos-phoribosyltransferase (APRT), which was used as aninternal ... site: Rbprm-for, 5¢-tcaagtcaggctagcGTTCCGCACCTATCAGCGCTCC-3¢ (630 nt); Rbprm-rev, 5¢-cagtgctgcctcgagGACGCCTTTCGCGGCGGGAGC-3¢ (1 nt). The PCR productwas sequenced using Big Dye v2.0 (PE Biosystems)....
- 14
- 486
- 0
Báo cáo khoa học: Dual expression of mouse and rat VRL-1 in the dorsal root ganglion derived cell line F-11 and biochemical analysis of VRL-1 after heterologous expression pptx
... 5¢-ATGACTTCAGCCTCCAGCCCCCCA-3¢ and rVRL-1_R:5¢-GGGACTGGAGGACCTGAAGGGGCA-3¢, respect-ively) were used to clone the open reading frame of rVRL-1 in frame with GFP into the pcDNA3.1/CT-GFP-TOPOvector ... primers were designed according to the ratVRL-1 sequence (Acc. No. AF129113).rVRL-1–34F: 5¢-CTGGAGACTTCCGATGGAGA-3¢ and rVRL-1–568R: 5¢-CATCCGCTCCATTCTCTACC-3¢ to obtain fragment A with 534 ... P761 and the stop codon into pcDNA3.1/CT-GFP-TOPO vec-tor. The resulting sequence was identical to GenBanksequence Acc. No. AF129113 with four single nucleotideexchanges in codons at amino acid...
- 8
- 439
- 0
báo cáo sinh học:" Nurses'''' experiences of recruitment and migration from developing countries: a phenomenological approach" pdf
... professionalnursing practice that is common in Irish nursing practice.These included issues such as care planning and makingnursing care decisions for patients in a system thatrequired a greater degree of ... contributing to the shortage of nurses.High-income countries also face an increased demand fornurses due to the ageing workforce caring for increasingnumbers of elderly people [7], and young ... low-income to middle and high-income countries. Recruitment practices of manycountries such as Ireland are thought to be fuelling this rate of migration. This paper aims to establish the perceptions...
- 7
- 473
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ