0
  1. Trang chủ >
  2. Kỹ Thuật - Công Nghệ >
  3. Điện - Điện tử >

báo cáo sinh học:" Motivation and job satisfaction among medical and nursing staff in a Cyprus public general hospital" pdf

báo cáo sinh học:

báo cáo sinh học:" Motivation and job satisfaction among medical and nursing staff in a Cyprus public general hospital" pdf

... non-financial incentives and motivating factorswere appreciation by managers, colleagues and the com-munity, a stable job and income and training. A studyfrom Mali based on a mixed-methods approach ... article as: Lambrou et al.: Motivation and job satisfaction among medical and nursing staff in a Cyprus public general hospital.Human Resources for Health 2010 8:26.Submit your next manuscript ... analyses, each motivationalfactor was regressed against socio-demographic variables(gender, age), work related variables (years in service,managing people) and job satisfaction, and the resultsare...
  • 9
  • 542
  • 1
Báo cáo sinh học:

Báo cáo sinh học: "Value of large scale expansion of tumor infiltrating lymphocytes in a compartmentalised gas-permeable bag: interests for adoptive immunotherapy" potx

... irradiated LAZ cells) areplated in sixty 96-well plates for stimulation. Ten days later, TIL are pooled and expanded in culture bags before being administered to patients(see “Materials and ... withidentical TIL and feeder cell ratios and total cell con-centration to those u sed in the standard protocol withplates. Preliminary data indicate that by increa sing thecell concentration in the ... Khammari A, Pandolfino MC, Tessier MH, Bercegeay S,Cassidanius A, Lemarre P, Billaudel S, Labarriere N, Jotereau F: Randomizedtrial of adoptive transfer of melanoma tumor-infiltrating lymphocytes asadjuvant...
  • 9
  • 397
  • 0
báo cáo sinh học:

báo cáo sinh học:" The double burden of human resource and HIV crises: a case study of Malawi" docx

... professional and technical cadres, coupled with a major initiative to recruit and re-engage qualifiedMalawian staff. • Expanding domestic training capacity, including dou-bling the number of nurses and ... hospitalcare in many rural areas. Medical assistants receive twoyears of training and mainly provide medical care in health centres and the outpatient departments of districthospitals. HSAs receive ... enrolments. Quoted in [31]. .26. Harries AD, Hargreaves NJ, Kwanjana JH, Gausi F, Kwanjana JH,Salaniponi FM: High death rates in health care workers and teachers in Malawi, Transactions of Royal Society...
  • 13
  • 585
  • 0
báo cáo sinh học:

báo cáo sinh học:" Key factors leading to reduced recruitment and retention of health professionals in remote areas of Ghana: a qualitative study and proposed policy solutions" doc

... Collaborative HealthAlliance for Reshaping Training, Education and Research (CHARTER) grantawarded by the Bill and Melinda Gates Foundation (Grant number: 50786).Ghana-Michigan CHARTER is a collaborative ... in areas where you are not fully trained.” (UW)Occasionally a young doctor in GA complained aboutthe lack of hands-on practice in the teaching hospitals,but mentoring in GA was largely characterized ... step out of public serviceifappointedtoahardshippost.Atthesametime, it was clear that there is an important social pres-tige afforded to academic and clinical leade rs in Ghana, and that this prestige...
  • 11
  • 707
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Genetic characterisation of the recent foot-and-mouth disease virus subtype A/IRN/2005" pptx

... India99AF390623 A India99AF390659 A India2001AF390630 A India99AF390626 A India99AF390638 A India99AF390636 A India99AF390672 A India93AF390640 A India99AF390637 A India99AF390641 A India88AF390608 ... 2006OO A ASIA1ASIA1ASIA1, A, O A A22OOAsia1, A, O A AAsia1, A 0.1EF611987 Uganda 2006 AY593823 O1 Manisa AY687333 Asia1 India01 AY593799 Asia1 Leb4 AY593798 Asia1 Leb89 AY593800 Asia1 ... India01AY687334 Asia1 India97AY593800 Asia1 Leb83AY593798 Asia1 Leb89AY593799 Asia1 Leb4AF390612 A India88AF390652 A India97 AF390615 A India94AF390622 A India99AF390593 A India99AF390605 A India99AF390623...
  • 12
  • 556
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Comparison between 68Ga-bombesin (68Ga-BZH3) and the cRGD tetramer 68Ga-RGD4 studies in an experimental nude rat model with a neuroendocrine pancreatic tumor cell line" ppt

... assess tissue viability, thereby gain the staging and therapy monitoring by qualitative analysis of SUV and quantitative evaluation based on the compartmental analysis of kinetic parameters [2]. ... the application of radiolabeled somatostatin analogs in nuclear medicine for diagnostics and therapy of neuroendocrine tumors has achieved success and stimulated the research in receptor targeting ... A JAVA environment for medical image data analysis: initial application for brain PET quantitation. Med Inform 1998; 23:207–214. 26. Burger C, Buck A: Requirements and implementations of a...
  • 23
  • 350
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Curcumin reduces expression of Bcl-2, leading to apoptosis in daunorubicin-insensitive CD34+ acute myeloid leukemia cell lines and primary sorted CD34+ acute myeloid leukemia cells" pptx

... Hussain AR, Al-Rasheed M, Manogaran PS, Al-Hussein KA, Platanias LC, Al-Kuraya K, Uddin S: Curcumin induces apoptosis via inhibition of PI3’-kinase/AKT pathway in acute T cell leukemias. Apoptosis ... performedusing a reverse transcriptase first strand cDNA synthesiskit (Takara, Japan). The sequences of the sense and anti-sense primers were: 5’ -CTGGTGGACAACATCGC-3’(sense) and 5’ -GGAGAAATCAAACAGAGGC-3’ ... KB,Sung B, Tharakan ST, Misra K, Priyadarsini IK, Rajasekharan KN, Aggarwal BB:Biological activities of curcumin and its analogues (Congeners) made byman and Mother Nature. Biochem Pharmacol 2008,...
  • 15
  • 415
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Combination therapy with vemurafenib (PLX4032/RG7204) and metformin in melanoma cell lines with distinct driver mutations" pdf

... total proteins and b-actin was usedas a loading control. Phosphorylation was analyzed with antibodiesagainst pRAF, pMEK, pERK, pLKB1, pAMPKa, pACC, pS6K, pS6, and theirtotal proteins. a) BRAFV600Emutant ... experimentswas performed in an LSR-II (BD Biosciences) and datawas analyzed using FlowJo (Tree Star Inc, Asland, OR).Apoptosis analysisCells were plated in 6-well plates and treated withDMSO, vemurafenib, ... inhibition and metabolicmodulation of AMPK would be more effective thaneither manipulation alone in arresting melanoma cellproliferation. We tested a combination of vemurafenib and metformin in a panel...
  • 13
  • 518
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Cytotoxic T lymphocyte responses against melanocytes and melanoma" pdf

... 5’-AGTTCTAGGGGGCCCAGTGTCT-3’, (AS): 5’-GGGCCAGGCTCCAGG-TAAGTAT-3’; MART-1 (Melan -A) (S):5’-TGACCCTA-CAAGATGCCAAGAG-3’, (AS): 5’-ATCATGCATTGCAACATTTATTGATGGAG-3’. The real-time qRT-PCRwas performed in single ... MeWo are HLA -A* 0201-positive and express MAAs gp100, MART-1, and tyrosinase. A3 75is also a HLA -A* 0201-positive melanoma line but is defec-tive in intracellular processing and MHC presentation ofgp100, ... study, participated in its design and coordination and drafted the manuscript. All authors read and approved the final manuscript.Competing interestsThe authors declare that they have no competing...
  • 10
  • 312
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Comparisons of the M1 genome segments and encoded µ2 proteins of different reovirus isolates" pptx

... 2304T2S59 GCGUGAUCCGUGACAUGCGUAGUAUGACACCUGCCCCCAGGUCAAAGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304T3C12 GCGUGAUCCGUGACAUGCGUAGUGUGACACCUGCUCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304T3C18 ... 2304T1L GCGUGAUCCGUGACAUGCGUAGUGUGACACCUGCCCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304T2J GCGUGAGUCGGGUCAUGCAACGUCGAACACCUGCCCCAUGGUCAAUGGGGGUAGGGG CGGGCUAAGACUACGUACGCGCUUCAUC 2303T3D ... 2304T1C11 GCGUGAUCCGUGACAUGCGUAGUGUGACACCUGCCCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304T1C29 GCGUGAUCCGUGACAUGCGUAGUGUGACACCUGCCCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304T1N84...
  • 17
  • 379
  • 0

Xem thêm

Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcbáo cáo trường học thân thiện học sinh tích cực tiểu họcbáo cáo trường học thân thiện học sinh tích cực violetbáo cáo trường học thân thiện học sinh tích cực 2013Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ