báo cáo sinh học:" The distribution and transitions of physicians in Japan: a 1974–2004 retrospective cohort study" pot
báo cáo sinh học:" The distribution and transitions of physicians in Japan: a 1974–2004 retrospective cohort study" pot
... female physicians, the percentages of physicians working in rural areas and the average ages of physicians. The national population in these years wasobtained by referring to the Japan Population ... contributionsAll the authors conceived the study and jointly designed and conducted it. HI and HY analysed the data and all the authors interpreted the results. HI and HY drafted the manuscript, and all the ... Short-age of pediatricians in Japan: a longitudinal analysis using Physicians& apos; Survey Data. Pediatr Int 2009 in press.8. Shimada N, Kondo T: Estimation of actual report rates usingdata from...
- 10
- 588
- 0
báo cáo sinh học:" The training and expectations of medical students in Mozambique" doc
... in the 1998/99 academic year at the Universi-dade Eduardo Mondlane (UEM) Medical Faculty in Maputo, with the aim of identifying their social and geo-graphical origins and their expectations and ... selection of medical students, there are – in several countries including some in Africa – pro-grammes based on affirmative action aiming to increase the intake of medical students from disadvantaged ... wereunhappy or partially unhappy with it and 20% did nothave any opinion.Regarding the quality of the training received, 52% felt itwas adequate or very adequate, 20% that it was inade-quate...
- 7
- 493
- 0
Báo cáo khoa học:The isolation and characterization of temperature-dependent ricin A chain molecules in Saccharomyces cerevisiae docx
... the mature ORF of RTA wereCP172 5¢-ATATTCCCCAAACAATACCC-3¢ and the anti-sense primer CP133 5¢-TTAAAACTGTGACGATGGTGGA-3¢ with the TAA termination anticodon shown in bold. Amplification reactions ... ricin, in particular itsroute into target cells and the fate of its two subunits,RTA and the cell-binding galactose-specific lectinricin toxin B chain (RTB), are essential to gain furtherinsights ... following toxin-mediated damage in vivo. Per-centage depurination was determined by quantifying the intensity of the liberated fragment in relation to the remaining intact25S rRNA plus fragment...
- 14
- 411
- 0
Báo cáo sinh học: " Tumor escape and progression of HER-2/neu negative breast cancer under immune pressure" potx
... primers.ECD-forward: 5’ AAA CTC GAG ATG GAG CTGGCG GCC TTG T 3’ and reverse: 5’ CTT AAG CTTCGT CAG AGG GCT GGC TCT CT 3’ ;ICD-forward:5’ AAACTCGAGAAGCGACGGCAGCAGAAGAT 3’ and reverse: 5’ CTT AAG CTT TCA ... analysis, HDB coordinated clinical aspects of the study including patient’saccrual and participated in drafting the manuscript, MHM conceived the study, designed the experiments, analyzed data ... Michael O Idowu2, Margaret M Grimes2, Laura Graham3, Maria-Libera Ascierto4,Ena Wang4, Xiang-Yang Wang5, Harry D Bear3 and Masoud H Manjili1*AbstractBackground: Emerging data from...
- 5
- 374
- 0
báo cáo sinh học:" The training and professional expectations of medical students in Angola, Guinea-Bissau and Mozambique" pot
... describe and analyze the professional expec tations of medicalstudents during the 2007-2008 academic year at the public medical schools of Angola, Guinea-Bissau and Mozambique, and to identify their ... 2008. Some of the questions w ere context-specific and adapted to the rea-lity of each country. All data were entered into anAccess database and analysed using SPSS. Statisticalanalysis was mostly ... (Mozambique), Agostinho Neto (Angola) and RaulDiaz Arguellez (Guinea-Bissau), to identify where theycome from and their expectations and difficultiesregarding their education and their professional career.MethodsA...
- 5
- 382
- 0
báo cáo sinh học:" The human resource for health situation in Zambia: deficit and maldistribution" docx
... needs and to adapt training programs to include them; an example is that of training clinical care specialists, who are physicians who receive further training to assume clinical management ... use official data from 2008 to analyse various dimensions of the health workforce, such as vacancies, attrition, and geographical imbalances. The case of Zambia reinforces the idea that training ... which in the early 2000’s was estimated at 10% of qualified workers in Zambia, 16% in Tanzania, 26% in Angola , 36% in Madagascar , 42% in Mozambique, and 48% in Mauritius. For nurses, the rate...
- 29
- 327
- 0
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt
... charac-terization of the NrfH subunit. The four NrfH hemes are all in a low-spin state (S ¼ 1/2). One of them has a gmaxat 3.55,characteristic of bis-histidinyl iron ligands in a noncoplanararrangement, and ... desulfuri-cans ATCC 27774 NrfA [17] enabled to ascertain the spatial characterization of the five hemes, namely theirproximity and the axial histidine plane angles (Fig. 7). A correlation between individual ... gmax of 2.96 that is EPR detectable and is magneticallyisolated. Structurally, it is distant from the remaining hemes and the dihedral angles of the axially coordinated Hissupport this assignment...
- 12
- 593
- 0
Tài liệu Báo cáo khoa học: "The Structure and Process of Talking About Doing" pdf
... a oct+sAn aununS, with a oor~aAn smotmt oF nalIAenoln, and ~he more oaIAent a preoeaa As, 5he lar|er %5e %npae5 on oSher presences (and therefore on the overall prooeaoLng). There ere ... name tank. Than %e the evaluatAon 5eat oemmon%y used today For strafe.sial AntelIA|enee models. A more r~l;orous 5eat %e 5n Cry to F~.5 a mode/. 50 • emma OF data. ?hAs ~e the evaluate.on ... ~Ant about 5h ~a ~rt~e~ar example %8 5hat ~t %e embedded wlthAn an "el~mlnatAon of alternat£voo" arll~Nnt etruoture. The5 %a, 5hAm "prqitAo arluaent" 18 used 50 el~aAnaSe...
- 4
- 584
- 0
Báo cáo khoa học: The HS:19 serostrain of Campylobacter jejuni has a hyaluronic acid-type capsular polysaccharide with a nonstoichiometric sorbose branch and O-methyl phosphoramidate group docx
... Szymanski and Jean-Robert BrissonInstitute for Biological Sciences, National Research Council of Canada, Ottawa Ontario, CanadaCampylobacter jejuni is one of the leading causes of human gastroenteritis ... gastroenteritis and surpasses Salmonella, Shig-ella and Escherichia in some regions as the primarycause of gastrointestinal disease [1–3]. There is also a convincing body of evidence linking C. jejuni infectionsto ... [-4)-b-d-GlcA6NGro-(1–3)-b-d-GlcNAc-(1-]nrepeating unit, where NGro is 2-aminoglycerol. A labile a- sorbofuranose branch located at C2 of GlcA was determined tohave the l configuration using a novel pyranose oxidase assay and...
- 15
- 430
- 0
Báo cáo khoa học: "THE SYNTAX AND SEMANTICS OF USER-DEFINED MODIFIERS IN A TRANSPORTABLE NATURAL LANGUAGE PROCESSOR" pot
... portable natural language data base interface. Cmlf. on Ap'1)lied Nc~t~ral L~znguage Processing, Santa Munica, Ca., 1983, pp. 25-30. 25. Grosz, B. TEAM: A transportable natural language ... grammatical formalism for transportable natural language processing, llm~r. J. Cow~p~t~zt~na~ L~n~ist~cs, to appear. Biermann, A. and Ballard, B. Toward natural language computation. Am~r. ... based upon the sorts of conceptual relationships that can occur in the "layered" domains of interest [1]. Finally, the macro file contains the meanings of modifiers, roughly in the...
- 5
- 452
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtthe production and exchange of goods in an integrated market place the role of agricultural production and trade in dietary transitionsdigital image processing techniques for the detection and removal of cracks in digitized paintings pdfdigital image processing techniques for the detection and removal of cracks in digitized paintings pptdigital image processing techniques for the detection and removal of cracks in digitized paintingsthe nature and location of earthquakes in australiathe role and importance of communication in societythe syntax and semantics of wanting in indonesian3 what are the advantages and disadvantages of studying disease using a casecontrol studyNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật