báo cáo sinh học:" A cost-effectiveness study of caesarean-section deliveries by clinical officers, general practitioners and obstetricians in Burkina Faso" doc
Báo cáo y học: "A pilot study of rizatriptan and visually-induced motion sickness in migraineu"
... study, using a small number of subjects, we addressed the hypotheses that rizatriptan acts as a protective agent against visually-induced motion sickness in migraineurs and that rizatriptan ... trial was conducted in accordance with the guidelines of the International Conference on Har-monization for Good Clinical Practice and the study protocol was approved by a local Institutional ... Severity of ab-normalities in each category are rated by the subject and technician, with a range of scores for nausea of 0 to 16, for skin color of 0 to 8, for cold sweating of 0 to 8, salivation...
- 6
- 504
- 0
Báo cáo y học: "A Randomized Study of Epithelial Ovarian Cancer: Is Chemotherapy Useful after Complete Remission"
... al. Impact of Adjuvant Chemotherapy and Surgical Staging in Early-Stage Ovarian Carcinoma: European Organisation for Research and Treatment of Cancer–Adjuvant ChemoTherapy in Ovarian Neoplasm ... Venkatraman ES, et al. A phase II trial of intraperitoneal cisplatin and etoposide as consolidation therapy in patients with stage II-IV epithelial ovarian cancer following negative surgical assessment. ... Falcone A, Chiara S, Franzone P, et al. Moving-strip abdomino-pelvic radiotherapy after cis-platinum-based chemotherapy and second-look operation. A feasibility study in advanced ovarian cancer....
- 10
- 420
- 0
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx
... 465-472. Andrew, G. and Gao, J. 2007. Scalable training of L1-regularized log-linear models. In ICML. Charniak, E. 2000. A maximum-entropy-inspired parser. In NAACL, 132-139. Charniak, E. and ... epochs, and N is the number of training samples. 3 Evaluations From the four tasks we consider, parsing and lan-guage model adaptation are both examples of re-ranking. In these tasks, we assume ... 2007.c2007 Association for Computational Linguistics A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing Jianfeng Gao*, Galen Andrew*, Mark Johnson*&,...
- 8
- 504
- 0
Báo cáo khoa học: A kinetic study of sugarcane sucrose synthase pdf
... metabolism[9] and further examples of its application are given therein,as well as practical advice on isolation and assay of plantenzymes and extraction of metabolites. It should bementioned that plants ... on individual enzymes immensely and can have bothexplanatory and predictive value.Several papers that give a n overview of different approa-ches for studying and modelling metabolism, such asmetabolic ... activity, at about a 4% increase and 9% d ecrease in sucrose for a doubling and halving of activity, respectively. Sucrose futile cycling was about 7%higher in the models containing the SuSyC isoform,compared...
- 7
- 414
- 0
Báo cáo khoa học: "A Pilot Study of Opinion Summarization in Conversations" docx
... contains opinion. To obtain this,we trained a maximum entropy classifier with a bag -of- words model using a combination of data sets from several domains, includingmovie data (Pang and Lee, 2004), ... Philadelphia.Andrew Hayes and Klaus Krippendorff. 2007. Answer-ing the call for a standard reliability measure for cod-ing data. Journal of Communication Methods and Measures, 1:77–89.Minqing ... lex-ical and prosodic features. ACM - Transactions onSpeech and Language Processing.Shih Hsiang Lin, Berlin Chen, and Hsin min Wang.2009. A comparative study of probabilistic rankingmodels...
- 9
- 442
- 0
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot
... Micciulla, and J. Makhoul. 2006. A study of translation edit rate with targeted human annotation. In Proceeding of AMTA. T. Takezawa, E. Sumita, F. Sugaya, H. Yamamoto, and S. Yamamoto. 2002. ... Toward a broad-coverage bilingual corpus for speech translation of travel conversations in the real world. In Proceeding of LREC-2002, Las Palmas de Gran Canaria, Spain. D. Xiong, Q. Liu and ... from Machine Translation Systems. In Proceeding of EMNLP. Hawaii, US, Oct. F. Huang and K. Papinent. 2007. Hierarchical System Combination for Machine Translation. In Proceed-ings of the...
- 8
- 546
- 1
Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf
... onDialogue ManagementAlexandros PapangelisNCSR ”Demokritos”,Institute of Informatics& Telecommunications and Univ. of Texas at Arlington,Comp. Science and Engineeringalexandros.papangelis@mavs.uta.eduAbstractAdaptive ... years ADShave seen a lot of progress and have attracted theresearch community’s and industry’s interest.There is a number of available ADS, apply-ing state of the art techniques for adaptation ... Note that SARSA(λ), Q-Learning, Q(λ) and AC-QV are significantly faster than the restalgorithms.On the other hand, all algorithms except forNAC, IAC and LS-SARSA have the major draw-back of the...
- 10
- 498
- 0
Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx
... (Tc00.1047053510659.240) wasamplified by PCR from genomic DNA using the sense pri-mer 5¢-AAGCTTATGTCAACACGACGACTTATGCAC A- 3¢ and the antisense primer 5¢-GGATCCGGATCCTTAAGCCGTTCCCTGTTC-3¢ with additional HindIII and BamHI ... notmaintain an intact glyoxalase system, and may metabolize methylglyoxal via methylgly-oxal reductase (MeGR) and lactaldehydedehydrogenase (LADH) toL-lactate. Solidlines: confirmed metabolism ... Bhattacharyya N,Ray M & Ray S (2006) In vivo assessment of toxicity and pharmacokinetics of methylglyoxal – augmentation of the curative effect of methylglyoxal on cancer-bear-ing mice by...
- 11
- 639
- 0
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot
... ATATATCATATGTCCGGTGTCGCAAAGR-TryX ATATAGGATCCTTACTCGTCTCTCCACGGF-TryP1 ATATATCATATGTCCTGCGGTAACGCCR-TryP1 ATATAGGATCCTTACTGCTTGCTGAAGTATCF-TDPX1 Cys35Ala CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCGR-TDPX1 Cys35Ala ... codons of the mutated amino acids are in bold.Cloned protein or mutation primer (5’- to 3’)F-TDPX1 TATATCATATGTCTATCTACGACTTCAAGGTCR-TDPX1 ATATAGGATCCTCACGATTGAGTGCTTGGF-TryX ATATATCATATGTCCGGTGTCGCAAAGR-TryX ... CGCCCTTGGTGAAGCCGGCCTTGCTGGCTACGTTGF-TDPX1 Cys64Ala GGTACTGGCGTTCCCGGCCAACCAGTTCGCCGGTCR-TDPX1 Cys64Ala GACCGGCGAACTGGTTGGCCGGGAACGCCAGTACCF-TDPX1 Cys83Ala AGGTGAAAAGTTTCGCCGCCACGCGTTTCAAGGCTGAGR-TDPX1...
- 16
- 483
- 0
Báo cáo khoa học: A spectroscopic study of the interaction of isoflavones with human serum albumin pdf
... thebinding site of HSA has space and appropriate shape and residues to accommodate both warfarin and geni-stein. A crystal structure of HSA bound to warfarin isavailable (PDB no. 1h9z and 1 ha2) ... experimental findings and support theidea of simultaneous binding of warfarin and genistein in HSA.Experimental proceduresMaterialsHuman serum albumin (A- 1653), BSA (A- 7638) warfarin (A- 2250), diazepam, ... available at the binding site of HSA in order to accommodate genistein in additionto accommodating warfarin. Results obtained from theinteraction of genistein and warfarin to HSA by CDmeasurements...
- 17
- 457
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcbáo cáo trường học thân thiện học sinh tích cực tiểu họcbáo cáo trường học thân thiện học sinh tích cực violetbáo cáo trường học thân thiện học sinh tích cực 2013Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ