báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot
báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot
... managed the VCT training program from the Caribbean; and to Barbara McGaw (The Caribbean HIV/ AIDS Regional Training network [CHART], Kingston, Jamaica), who oversaw the VCT training program. ... Grenadines, and Surinam in 2003; to Barbados and the Bahamas in 2004; and to Anguilla, Antigua & Bar-buda, Dominica, Grenada, and Turks & Caicos in 2005.Clinical Skills CourseData from the ... skills and advanced training skills, as well as the number of trainingseach clinical trainer and advanced trainer had conductedsince the training.Follow-Up ActivitiesDrawing on contact information...
- 8
- 450
- 0
Báo cáo sinh học: " Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different asymmetric operator DNAs with variable affinity" ppt
... a standard proce-dure as indicated in Materials and method. (D) Summary of proteolysis. The putative domains of CI and its amino acid residues involved in formation of hinge, NTD and CTD are ... palas2004@gmail.com; Malabika Das - malavika_das@rediffmail.com; Nitai C Mandal - mandalnc2003@yahoo.com; Subrata Sau* - sau@bic.boseinst.ernet .in * Corresponding author AbstractBackground: Lysogenic mode of ... Ganguly, Amitava Bandhu, Partho Chattoraj, Palas K Chanda, Malabika Das, Nitai C Mandal and Subrata Sau*Address: Department of Biochemistry, Bose Institute, P1/12 CIT Scheme VII M, Kolkata – 700 054,...
- 8
- 494
- 0
Báo cáo sinh học: " Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/Alix" docx
... myristoylation of the Gag N-terminal region and subsequent targeting of the protein to the plasmamembrane. The interaction domain (I-domain) appearsto be a major region involved in Gag multimerization. The ... multimerization. The late assembly domain (L-domain) plays a critical role in pinching off of virus particles from the plasma mem-brane of infected cells. It has also been reported that inac-tivation of the ... described in A. B and D. Intensities of the bands corresponding to cell- and VLP-asso-ciated Gag in A and C were quantified using the LAS3000 imaging system (Fuji film). The efficiency of Gag-induced...
- 5
- 303
- 0
Báo cáo sinh học: "Inhibition of mitotic kinase Aurora suppresses Akt-1 activation and induces apoptotic cell death in all-trans retinoid acid-resistant acute promyelocytic leukemia cells" ppt
... in critical analysis of results.QL participated in conception and design, analysis and interpretation of data, and critical revision of the manuscript. All authors read and approved the final ... 14:719-29.14. Mazumdar A, Henderson YC, El-Naggar AK, Sen S, Clayman GL: Aurorakinase A inhibition and paclitaxel as targeted combination therapy forhead and neck squamous cell carcinoma. Head Neck ... participated in analysis and interpretation of data, and critical revision of the manuscript. SH, ZJL, JJC and ZZZ have made substantial contributionsto acquisition of data. JL and DJL participated...
- 12
- 392
- 0
Báo cáo sinh học: " Inhibition of human immunodeficiency virus type-1 (HIV-1) glycoprotein-mediated cell-cell fusion by immunor (IM28)" docx
... carried out and participated in the biologicaltests. M-Y A carried out and participated in the biologicaltests. B O carried out and participated in the biologicaltests. E M participated in ... pro-gram. Only P < 0.05 was considered significant.Authors' contributionsD M coordinated and participated in the design of the study, statistical analysis and the drafting of the manu-script. ... of syncytia formation = I.Statistical analysisData were analyzed by one-way analysis of variance(ANOVA) followed by Dunnett' test. All analyses wereperformed using the Graph-Pad Prism®...
- 6
- 382
- 0
Báo cáo hóa học: " Role of protease-activated receptor-2 on cell death and DNA fragmentation in Helicobacter pylori-infected gastric epithelial cells" ppt
... members: PAR-1, PAR-2, PAR-3 and PAR4. The co agulant protease throm bin is the physiolo-gical activator of PAR-1, PAR-3, and PAR-4. PAR-2 isactivated by multiple trypsin-like serine proteasesincluding ... Sato D, Yanaka A, Shibahara T, Matsui H, Nakahara A, Yanagawa T, Warabi E,Ishii T, Hyodo I: Peroxiredoxin I protects gastric mucosa from oxidativeinjury induced by H. pylori infection. J Gastroenterol ... celldeath and DNA fragmentation.Inhibition of PAR-2 expression suppresses H. pylori-induced activation of MAPK in gastric epithelial cellsTo determine the role of PAR-2 on the activation of MAPK,...
- 7
- 399
- 0
Báo cáo hóa học: " Deletion of human metapneumovirus M2-2 increases mutation frequency and attenuates growth in hamsters" potx
... NCRrhMPV/'M2-2/GFPpolyA:CATTTAAAT TAGTAAAAACACATCAGAGTGGGATAAATGACAatgSwa I SH startcodonM2/SH NCRdeletion in M2-2CGAAAAAATTA11 ntPoly A insertGCTAGCTTAAAAAAGTGGGACAAGTCAAA atg GTG ... ATTTAAAT TAGTAAAAACACATCAGAGT GGG ATAAATGACAatgdeletion in M2-2M2-2 stopcodon and SwaIDreading frame of GFP: ATG GTG AGC (in frame)reading frame of GFPpolyA: ATG GTG CGA AAA AAT TAA GCA ... rhMPV/GFPpolyA, an 11 nt Poly A insert wascloned into the NheI-N/P-GFP-NheI cassette using the primer 5'TGAGCTAGCTTAAAAAAGTGGGACAAGTCAAAATGGT-GCGAAAAAATTAAGCAAGGGCGAGG (hMPV P gene startsequences...
- 14
- 435
- 0
Báo cáo hóa học: " Detection of seroconversion to West Nile virus, Usutu virus and Sindbis virus in UK sentinel chickens" doc
... arrival of migratory birds from Africa, Europe and the Middle East and also being the warmest time of the year when mosqui-toes would be relatively active and therefore capable of transmitting ... 10 days old, the proportion of maternally derived neutralization positivesera against the two strains of WNV and against USUV haddropped to 2/20, 0/20 and 2/20 respectively and at days21 and ... the endpoint for individual sera. In addition we also included USUV and SINV in this analysisbecause it extended the range of viruses analysed and alsoserved as a form of internal control for...
- 6
- 359
- 0
báo cáo sinh học:" Development of a quality assurance handbook to improve educational courses in Africa" docx
... approval and reviewprocesses, support for students and staff training and welfare. It has been piloted in Ghana and the feedback was incorporated into the handbook. The handbook is currently available ... for plagiarism and collu-sion.4. Quality assurance of approval and review processesAimTo maintain the academic quality of courses and ensurethat courses remain relevant in the light of developingknowledge ... for example. The abolition of tutorials atMakerere University in Uganda was associated with a per-ceived decline in academic standards and a review recom-mended the reinstitution of tutorials...
- 5
- 488
- 0
báo cáo sinh học:" Analysis of a survey on young doctors'''' willingness to work in rural Hungary pptx
... areas rural that are not in the vicinity of a city having a medical university and/ or hav-ing a high level health care institution.This paper concentrates on potential effects of trainingon the ... hasgraduated from medical school and is spending the firsttwo years of postgraduate training in specialisation.These positions are centrally financed and offered in one of the four medical ... Budapest, the capital of Hungary. The human resources for health crisis is mainly a prob-lem in rural areas, and it is particularly severe in smalltowns and remote villages. Hospitals and clinics...
- 6
- 420
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtthe study on the effectiveness of creative writing activities in the warm up stage to motivate first year english major students at neu in integrated skills lessonsassessing the effectiveness of e customs procedures in the operations of quang ninh customs departmentthe application of a systematic disciplined and quantifiable approach to the development operation and maintenance of software that is the application of engineering to softwareexplain the concept of document object model in the context of javascriptc explain the concept of document object model in the context of javascriptemissions estimates from european countries anthropogenic em issions of pah tonnes year in the ece regionbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ