0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Hóa học - Dầu khí >

Báo cáo hóa học: "Prognostic impact of clinical course-specific mRNA expression profiles in the serum of perioperative patients with esophageal cancer in the ICU: a case control study" potx

Báo cáo hóa học:

Báo cáo hóa học: "Prognostic impact of clinical course-specific mRNA expression profiles in the serum of perioperative patients with esophageal cancer in the ICU: a case control study" potx

... this article as: Takahashi et al.: Prognostic impact of clinical course-specific mRNA expression profiles in the serum of perioperative patients with esophageal cancer in the ICU: a case control ... 11RESEARC H Open AccessPrognostic impact of clinical course-specific mRNA expression profiles in the serum of perioperative patients with esophageal cancer in the ICU: a case control studyShunsaku ... AGA AGT GG CCC TCA GTC AAG CGC TAC ATIL-6 MN_000600.3 ATG CAA TAA CCA CCC CTG AC TAA AGC TGC GCA CAA TGA GAb-actin MN_031144.2 ACC TGA CTG ACT ACC TCA TG GCA GCC GTG GCC ATC TCT TGTakahashi...
  • 11
  • 746
  • 0
báo cáo hóa học:

báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf

... GACTCAGAAA AGGACAAGGG GTGAGCCCAA CCACACAGCTGC-3'MCP-5: GenBank Accessions # AC012294, NC_0000775'-AAACACAGCTTAAAATAAAACAAAGAGGACGTGAGG-3'5'-CAACTACAGAATCGGCGTGTGCCA-3'5'-TCACGTGCTGTTATAATGTTGTTAAGCAGAAGATTCACGTCC-3'Journal ... confirm accuracy. A mutant sequence (5'-AAGCAGATTTGGTACCCT-TAGTCTTGCTTTAACGCTACTTTTCC AAGATAAGGTGACTCAGAAA AGGACAAGGG GTGAGCCCAACCACAAGGCTGCT-3') was generated by genomic PCRusing a ... 5'-AAGCAGACGTGGTAC-CCACAGTCTTGCTTTAACGCTACTTTTCCAAGATAAGGTGACTCAGAAAAG-GACAAGGGGTGAGCCCAACCACACAGCTGCT-3'3043nt) was PCR-amplified from genomic DNA isolatedfrom FHAs using a pair of primers...
  • 15
  • 541
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Prognostic impact of ZAP-70 expression in chronic lymphocytic leukemia: mean fluorescence intensity T/B ratio versus percentage of positive cells" pot

... along with the two clinical covariates (Table 1). Notably, regarding the prognostic impact of ZAP-70 expression in the threemultivariate models, the highest value of hazard ratio(HR) was associated ... (Fix&Perm kit, Caltag, Burlingame,CA) according to the manufacturer’s instructions, andfinally stained with the Alexa-488- conjugated anti-ZAP-70 mAb (clone 1E7.2, Caltag). A second tube was ... percentage of ZAP-70 positive cases decreased to37.2% (127/341 cases). Again, a para llel comparison of the prognostic impact of the two methods for ZAP-70evaluation clearly indicated a better...
  • 11
  • 688
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Prognostic Impact of MiR-155 in Non-Small Cell Lung Cancer Evaluated by in Situ Hybridization" pot

... et al: Prognostic significance of differentiallyexpressed miRNAs in esophageal cancer. Int J Cancer 2011, 128:132-43.37. Yamanaka Y, Tagawa H, Takahashi N, et al: Aberrant overexpression of microRNAs ... adenocarcinomas (ACs), 31 large cell carcino-mas and 18 bronchioloalveolar carcinomas. Due to nodalmetastasis or non-radical surgical margins, 59 (18%) patients received adjuvant radiotherapy.Interobserver ... studies have investigat ed the progn ostic impact of miR-155 in NSCLC, all using q uantitativeRT-PCR as the principal method [13,16,18]. Yanaiharaet al. [16], also using the median value as cut-off,...
  • 9
  • 662
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " cDNA targets improve whole blood gene expression profiling and enhance detection of pharmocodynamic biomarkers: a quantitative platform analysis" ppt

... assisted with the data analysisand participated in drafting and editing of the manuscript. SL completed the analysis of the protocol selection study, participated in the analysis of the SAHA data and ... contributed to the study design, participated in the expression profiling assays and participated in the ex vivo dosing study. DAparticipated in the expression profiling assays and participated in the ... participated in the drafting and editing of the manuscript. All authors read and approved the final manuscript.Competing interestsAll authors were employed by Merck & Co. at the time the...
  • 12
  • 585
  • 0
báo cáo hóa học:

báo cáo hóa học: " Reduced inflammation accompanies diminished myelin damage and repair in the NG2 null mouse spinal cord" potx

... kkucharo@sanfordburnham.org1Sanford-Burnham Medical Research Institute, La Jolla, CA 92037, USAFull list of author information is available at the end of the articleKucharova et al. Journal of Neuroinflammation 2011, ... 10sections, and all 20 values were then summed to obtain the total volume of demyelination. For animals of the same genotype and s urvival period, an average volume of demyelination was obtained and ... forward 5’-AGG TCA CAG GAG AAG GGA CGC C-3’IL-4 reverse 5’-TGC GAA GCA CCT TGG AAG CCC-3’IL-10 forward 5’-CTG GAC AAC ATA CTG CTA ACC G-3’IL-10 reverse 5’-GGG CAT CAC TTC TAC CAG GTA A- 3’IL-1b...
  • 13
  • 480
  • 0
Báo cáo khoa học: a-1 Antitrypsin binds preprohepcidin intracellularly and prohepcidin in the serum pdf

Báo cáo khoa học: a-1 Antitrypsin binds preprohepcidin intracellularly and prohepcidin in the serum pdf

... pathway by a 24-AA N-terminal targeting sequence. The resulting60-AA prohepcidin is processed further into a matureC-terminal 25-AA active peptide. The maturation isfacilitated by the serine ... thatobtained in the case of bacterially expressed His-taggedprohepcidin with a molecular weight of 7760.08 Da. In the latter case, two major peaks appeared in the spectrum, at m ⁄ z 1410.96 and ... directly involved in ironregulation. It is synthesized as an 84-amino-acid (AA)preprohormone, and is present in the plasma as a mature 25-AA peptide and as a 60-AA prohormoneform. Maturation is facilitated...
  • 10
  • 678
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Prognostic significance of Oct4 and Sox2 expression in hypopharyngeal squamous cell carcinoma''''" doc

... examined byimmunostaining using the primary antibodies overnightat 4°C in a humidity chamber. The avidin-biotinTable 1 The expressions of Oct4 and Sox2 and theirrelationships with clinicopathological ... pattern and lack of obvious earlysymptoms, hypopharyngeal squamous cell carcinoma is a cancer with the lowest survival rates among the headand neck subsites [3,4]. Although the standard therapy of ... hypothesis posits thattumors may be initiated and maintained by a subset of cells that maintain or acquire stem-cell properties andthat each tumor contains a small subpopulation of cellsthat...
  • 7
  • 493
  • 0
báo cáo hóa học:

báo cáo hóa học: " Additional impact of concomitant hypertension and osteoarthritis on quality of life among patients with type 2 diabetes in primary care in Germany – a cross-sectional survey" doc

... manuscript. All authors read anapproved the final manuscript.Acknowledgements The authors are grateful to the AOK Sachsen-Anhalt and the AOK Rhein-land-Pfalz for support in sending out the study material ... quality of life within a large sample of patients with type 2 diabetes in primary care.Methods: A cross-sectional survey within a large sample (3.546) of patients with type 2 diabetes in primary ... remark-able lower scales in all domains of the SF-36 in particularwithin the subscales related to physical well-being. The revealed high burden of patients with osteoarthritis is in accordance with...
  • 7
  • 458
  • 0
báo cáo hóa học:

báo cáo hóa học:" Bioactivity-guided identification and cell signaling technology to delineate the immunomodulatory effects of Panax ginseng on human promonocytic U937 cells" potx

... Healthcare) to detect the targetproteins.Data analysisAll data are presented as the mean ± standard deviation(SD) obtained from at least three separate experimentsand statistically analyzed ... on the inflammatory cascade. Ginsan, a polysaccharide extract from ginseng, enhances the phago-cytic activity of macrophages in mice infected with Staphy-lococcus aureus [9]. Ginsan also inhibits ... inflammatorydiseases.MethodsPreparation of 70% ethanol-water extracts of ginseng (PGSE) The Panax ginseng extract was provided by Prof WangJianxin (Shanghai Institute of Chinese Materia Medica,PRChina)....
  • 10
  • 500
  • 0

Xem thêm

Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam