Báo cáo hóa học: " S110, a novel decitabine dinucleotide, increases fetal hemoglobin levels in baboons (P anubis)" potx
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... antisense AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... Journal compilation ª 2009 FEBSTransLISA, a novel quantitative, nonradioactive assayfor transcription factor DNA-binding analysesKristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2and ... simultaneous binding of allDNA-binding domains in a trimer to three adjacentnGAAn repeats. Therefore, a functional HSE containsat least three nGAAn repeats. The promoters of mostHsp genes contain...
- 9
- 457
- 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf
... 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,andPDE1(Lys321–Thr620) was amplified with primers 5¢-GGGAATTCCATATGAAGAATGATCAATCTGGCTGCGGCGCAC-3¢ ... causes the fatalhuman sleeping sickness, as well as Nagana, a devastatingdisease of domestic animals in large parts of sub-SaharanAfrica. While many aspects of trypanosome cell biologyhave been ... original Kozaksequence 5¢-CTAAAC-3¢ and a start codon. The completeTbPDE1 ORF was expressed either containing a His6tagat its N terminus, or a His6tagfollowedbyahaemag-glutinin tag to facilitate...
- 11
- 566
- 0
Báo cáo khoa học: Phaiodotoxin, a novel structural class of insect-toxin isolated from the venom of the Mexican scorpion Anuroctonus phaiodactylus pdf
... andmammalian Na+channels. Accordingly, they are dividedinto classical a- toxins that are highly active in mammalianbrain, a- toxins that are very active in insects and a- liketoxins that are active ... phaiodotoxinThe amino acid sequence o f the N-terminal portion ofphaiodotoxin was obtained by Edman degradation carriedout with an automatic apparatus Beckman LF 3000 Pro-tein Sequencer (Palo Alto, ... from poly (A) + mRNA u sing M-MLV reverse tran-scriptase. The cDNA was joined with the a daptor providedby the kit (5 ¢-gcugauggcgaugaaugaacacugcguuugCUGGCUUUGAUGAAA-3¢) using T4 DNA ligase. The...
- 9
- 533
- 0
Báo cáo khoa học: Brox, a novel farnesylated Bro1 domain-containing protein that associates with charged multivesicular body protein 4 (CHMP4) potx
... Bro1domain-containing protein with a thioester-linkage siteof isoprenoid lipid (CAAX motif, C standing for cys-teine, A for generally aliphatic amino acid, and X forany amino acid)] in this article, ... University, JapanAlix (also named AIP1) is an interacting partner of thepenta-EF-hand Ca2+-binding protein, ALG-2 [1–5],and acts as a multifunctional adaptor protein in vari-ous cellular functions ... lipid(CAAX motif) (C standing for cysteine, A for generally aliphatic aminoacid, and X for any amino acid). Mammalian Alix and its yeast ortholog,Bro1, are known to associate with charged multivesicular...
- 11
- 412
- 0
Báo cáo khoa học: Plasmoredoxin, a novel redox-active protein unique for malarial parasites doc
... Kawazu, S., Tsuji, N., Hatabu, T., Kawai, S., Matsumoto, Y. &Kano, S. (2000) Molecular cloning and characterization of a peroxiredoxin from the human malaria parasite Plasmodium fal-ciparum. ... tertianmalaria in man.Interestingly, two similar sequence annotations (Gen-Bank accesson numbers, NP_473166 and CAB38989) wereavailable that proposed a large protein of 2417 and 2396amino acids, ... superfamily andshare structural and functional characteristics. In the mal-arial parasite, Plasmodium falciparum, a functional thio-redoxin and glutathione system have been demonstratedand are considered...
- 8
- 412
- 0
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot
... the N-terminal fragmentof the poneratoxin gene. Two others: forward 5¢-GCCGCCCGTGATACAGGCGATCCACGATGCGCAGAGGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTACTACCTCTGCGCATCGTGGATCGCCTGTATCACGGG-3¢ ... construction ofthe poneratoxin gene [11]. Two oligonucleotides: forward5¢-2GATCCATGTTTCTTCCGCTTCTGATCCTTGGCTCTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCAGAAGAGAGCCAAGGATCAGAAGCGGAAGAAACATG-3¢, were ... D.S. (1999) Interactions controllingthe membrane binding of basic protein domains: phenylalanineand the attachment of the myristoylated alanine-rich C-kinasesubstrate protein to interfaces. Biochemistry...
- 10
- 696
- 0
Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf
... ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG SmaIrFnBPB163–308F GGGGGATCCGGTACAGATGTAACAAATAAAG BamHIrFnBPB163–308R CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA SmaIrFnBPB309–480F CCCGGATCCTATTTAGGTGGAGTTAGAGATAAT ... (5¢–3¢) a, b5¢ restriction siterFnBPB37–480F CGGGGATCCGCATCGGAACAAAACAATAC BamHIrFnBPB37–480R AATCCCGGGTTACTTTAGTTTATCTTTGCCG SmaIrFnBPB163–463F GGGGGATCCGGTACAGATGTAACAAATAAAG BamHIrFnBPB163–463R ... CCCGGATCCTATTTAGGTGGAGTTAGAGATAAT BamHIrFnBPB309–480R AATCCCGGGTTACTTTAGTTTATCTTTGCCG SmaIrFnBPB163–480NF F GAATTATCTTTAGCTCTAGCTATTGATCCrFnBPB163–480NF F GGATCAATAGCTAGAGCTAAAGATAATTCFnBPB(–142–480)F...
- 13
- 514
- 0
Báo cáo khoa học: Existence of novel b-1,2 linkage-containing side chain in the mannan of Candida lusitaniae, antigenically related to Candida albicans serotype A potx
... oligo-saccharides; h,LM4;,LM5;j,LM6;s,Manb1fi2Mana1fi2Mana1fi2Mana1fi2Man; d,Manb1fi2Manb1fi2Mana1fi2Man a1 fi2Mana1fi2Man; n,Manb1fi2Mana1fi3Mana1fi2Mana1fi2Man; m,Manb1fi2Manb1fi2Mana1fi3Mana1fi2Mana1fi2Man.2572 ... oligosaccha-rides, Manb1fi2Mana1fi3Mana1fi2Mana1fi2Man andManb1fi2Manb1fi2Mana1fi3Mana1fi2Mana1fi2Manwere prepared from the mannan of C. guilliermondii [17]or C. saitoana [35] and Manb1fi2Mana1fi2Mana1fi2Mana1fi2Man ... b1fi2Mana1fi2Mana1fi2 15.58 5.233 4.096 a1 fi3Mana1fi2Mana1fi2Mana1fi2›6Mana109 5.130 4.065 Mana1fi3010 5.121 4.017 a1 fi6Mana1fi6Mana1fi6Mana1fi6›2Mana111 5.104 4.029 a1 fi6Mana1fi6Mana1fi6Mana1fi6›2 ›2 ›2Mana112...
- 11
- 456
- 0
![Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc](https://media.store123doc.com/images/document/14/rc/rp/small_luUKRIz7Xm.jpg)
Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc
... were incubated with the indicated concentrations of ACTH. In six separate experiments, the mean FFA concentration measured in the incubation media in absence of any pharmacological agents (basal ... that acute B [a] P treatment profoundlyimpaired catecholamine-induced lipolysis in bothmurine and human adipocytes. Furthermore, a signifi-cant weight gain, as well as increased fat mass, wasobserved ... foodintake was detected in the B [a] P-treated animals. In addition, the absolute values of leptin in control andB [a] P-treated animals were not significantly differentand remained within the normal...
- 11
- 424
- 0
Báo cáo khoa học: Characterization of novel sequence motifs within N- and C-terminal extensions of p26, a small heat shock protein from Artemia franciscana potx
... T169–T186 are missing.p26 region Mutation Primer sequenceN-terminal extension G 5¢-GGCACTTAACCCATGGTACATGGACCTTGATATTGAC-3¢5¢-GTCAATATCAAGGTCCATGTACCATGGGTTAAGTGCC-3¢R5¢-GGACCTTGATATTGACGGTCCAGATACC-3¢5¢-GGTATCTGGACCGTCAATATCAAGGTCC-3¢C-terminal ... 5¢-GGCACTTAACCCATGGTACATGGACCTTGATATTGAC-3¢5¢-GTCAATATCAAGGTCCATGTACCATGGGTTAAGTGCC-3¢R5¢-GGACCTTGATATTGACGGTCCAGATACC-3¢5¢-GGTATCTGGACCGTCAATATCAAGGTCC-3¢C-terminal extension TS 5¢-GGATTGAAGGGGGAAGATCAGGAGGTGC-3¢5¢-GCACCTCCTGATCTTCCCCCTTCAATCC-3¢Y. Sun and T. H MacRae Small heat shock protein sequence ... modification as indicated by intrinsic fluores-cence paralleled reductions in chaperone activity foreach p26 variant. WT p26 from bacteria and Artemiahad similar 1-anilino-8-naphthalene-sulphonate...
- 14
- 358
- 0
Từ khóa: bao cao hoa bai phan tich dinh tinh cac nguyên tố trong một hợp chat huu cobáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóađề thi cao đẳng môn hóa học khối a năm 2012quảng cáo trên báo giấy hoa học tròđề thi cao đẳng môn hóa học khối a năm 2011đề thi cao đẳng môn hóa học khối a năm 2010trang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caobai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ