báo cáo hóa học:" Circulating endothelial progenitor cells:

báo cáo hóa học:" Circulating endothelial progenitor cells: a new approach to anti-aging medicine?" docx

... for citation purposes) Journal of Translational Medicine Open Access Review Circulating endothelial progenitor cells: a new approach to anti-aging medicine? Nina A Mikirova 1 , James A Jackson 2 , ... Diego, California, USA, 10 Georgetown Dermatology, Washington, DC, USA and 11 Aidan Products, Chandler, Arizona, USA Email: Nina A Mikirova - nmikirova@brightspot.org;...

Ngày tải lên : 18/06/2014, 15:20

12
473
0

Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf

... Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' ... 07974. Barbara Brunson* AT&T Bell Laboratories and Department of Linguistics University of Toronto Toronto, Ontario, Canada M5S 1A1 . Abstract We present a model of morpholog...

Ngày tải lên : 08/03/2014, 18:20

8
522
0

báo cáo hóa học: " Reliability and validity of a new scale on internal coherence (ICS) of cancer patients" pot

... 1.8 Leiomyosarcoma 1 1.8 Melanoma 1 1.8 Ovarian carcinoma 2 3.5 Ovarian sarcoma 1 1.8 Pancreatic cancer 2 3.5 Pharyngeal cancer 1 1.8 Plasmocytoma 4 7.0 Pleural mesotelioma 3 5.3 Prostatic cancer 3 ... phys- iological parameters as postulated by Antonovsky [8,9], due to its origin, it focuses in particular on mental health. Already, in 1923 a first medical approach to salutogenesis wa...

Ngày tải lên : 18/06/2014, 18:20

11
622
0

báo cáo hóa học: "Validity and reliability of a new, short symptom rating scale in patients with persistent atrial fibrillation" pot

... satisfactory reliability and validity. Background To date there are few disease-specific instruments that assess symptoms of atrial fibrillation (AF), and they appear to be largely unvalidated and/or ... state, depression, worry and anxiety seem to play important roles and may affect the relapse rate of AF as well as the symptomatology and the quality of life [26,27]. 'Anxiety due...

Ngày tải lên : 18/06/2014, 18:20

10
497
0

báo cáo hóa học: " Integration of immigrants into a new culture is related to poor sleep quality" pptx

... by professional translators and translated back into German by the accompanying translators. The interview was iden- tical to the one given to the Moroccan women. Internal consistency (Cronbach's alpha) ... analyses and drafted the manuscript. Inka Tuin conceived of the study, participated in its coordination and the statistical analysis, and helped to draft the manuscript. All aut...

Ngày tải lên : 18/06/2014, 19:20

6
435
0

báo cáo hóa học:" Transplantation of vascular cells derived from human embryonic stem cells contributes to vascular regeneration after stroke in mice" docx

... Kenichi Yama- hara, Takami Yurugi-Kobayashi, Kwijiun Park, Naofumi Oyamada, Naoya Sawada, Daisuke Taura, Hirokazu Tsujimoto, Ting-Hsing Chao, Naohisa Tamura, Masashi Mukoyama, Kazuwa Nakao: The Neuroprotective ... Yurugi-Kobayashi, Akane Nonoguchi, Yutaka Suzuki, Ting- Hsing Chao, Naoki Sawada, Yasutomo Fukunaga, Kazutoshi Miyashita, Kwijun Park, Naofumi Oyamada, Naoya Sawada, Daisuke Taura,...

Ngày tải lên : 18/06/2014, 15:20

14
450
0

báo cáo hóa học:" Human embryonic stem cells hemangioblast express HLA-antigens" pot

... CGCTGTCTTCCTTCTGAACC ATCAGCACTCCCAGCAGAGT 282 60 GLI1 CTCTGAGACGCCATGTTCAA ATCCGACAGAGGTGAGATGG 282 60 ε-globin CACTAGCCTGTGGAGCAAGATGAA AATCACCATCACGTTACCCAGGAG 304 59 γ-globin CGCTTCTGGAACGTCTGAGGTTAT CCAGGAGCTTGAAGTTCTCAGGAT ... N 6A 5A5 , Canada Email: Grzegorz Wladyslaw Basak - gbasak@ib.amwaw.edu.pl; Satoshi Yasukawa - yasukawa-satoshi@jpo.go.jp; Andre Alfaro - aj_alfaro4@yahoo.com;...

Ngày tải lên : 18/06/2014, 15:20

10
409
0

báo cáo hóa học:" Bioactivity-guided identification and cell signaling technology to delineate the immunomodulatory effects of Panax ginseng on human promonocytic U937 cells" potx

... target proteins. Data analysis All data are presented as the mean ± standard deviation (SD) obtained from at least three separate experiments and statistically analyzed by two-tailed, paired t-test. The statistical ... contributes to airway hyperreactivity and airway inflammation in a mouse model of asthma. J Immunol 2002, 168:5278-5286. 29. Milner CM, Higman VA, Day AJ: TSG-6: a plurip...

Ngày tải lên : 18/06/2014, 15:20

10
500
0

báo cáo hóa học:" Retinal pigment epithelial cells secrete neurotrophic factors and synthesize dopamine: possible contribution to therapeutic effects of RPE cell transplantation in Parkinson''''s disease" doc

... volume. cDNA was used as template in the following PCR assay. The primers used for PCR assays were as follows: (1) DDC, forward: 5'-TTACTCATCCGATCAGGCACAC-3', reverse: 5'-GGCAGAACAGTCAAAATTCACC-3'; ... 5'-GGCAGAACAGTCAAAATTCACC-3'; (2) DAT, forward: 5'-CGAGGCGTCTGTTTGGAT-3', reverse: 5'- CAGGGAGTTGATGGAGGTG-3'; (3) GAPDH, forward: 5'-CCAT...

Ngày tải lên : 18/06/2014, 15:20

9
449
0

Báo cáo hóa học: " Three-day dendritic cells for vaccine development: Antigen uptake, processing and presentation" pot

... HLA -A2 molecules. Acti va- tion of CTL A4 2 was measured by IFN-g release. The MART-1/Melan -A- negative melanoma cell line Mel A3 75 and the MART-1/Melan -A- positive melanoma cell line Mel -93.0 4A1 2 ... ivtRNAisanattractivesourceofanti- gen that can be easily and cheaply generated from any antigen-encoding cDNA. To analyze this as a source of antigen, immature and mature DC were el...

Ngày tải lên : 18/06/2014, 16:20

13
412
0