0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Hóa học - Dầu khí >

báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx

báo cáo hóa học:

báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx

... hepatic cancer, colon cancer and lung cancer. Immunostaining of prostate cancer tissue with antibodies against AMACR and PSAFigure 2Immunostaining of prostate cancer tissue with antibodies against ... mRNA in prostate cancer line LNCaP, but only very weak expression of AMACR mRNA was observed in normal adult liver and pancreas (Figure 1A) . In contrast, the AMACR mRNA levelwas elevated in all ... AbstractAlpha-methylacyl-CoA racemase (AMACR) is an enzyme playing an important role in the beta-oxidation of branched-chain fatty acids and fatty acid derivatives. High expression levels of...
  • 11
  • 531
  • 0
Báo cáo Y học: The group I-like ribozyme DiGIR1 mediates alternative processing of pre-rRNA transcripts in Didymium iridis pptx

Báo cáo Y học: The group I-like ribozyme DiGIR1 mediates alternative processing of pre-rRNA transcripts in Didymium iridis pptx

... doi:10.1046/j.1432-1033.2002.03283.xGTTCAGAGACTATA-3¢;OP169,5¢-ACCTAAGGCGGACGTTACTG-3¢;OP180,5¢-GCCTCCCTTGGGATAT-3¢; OP448, 5¢-AACCGAACAATGAGACTGAA-3¢;OP449, 5¢-CTCGTATTCGAAGGCATGCA-3¢;C78,5¢-TGCTTCCTTTCGGAACGA-3¢; C231, 5¢-ATTCCGATATCGTGCTCTA-3¢; C232, 5¢-AAGAGGTTGGCCAAGGAA-3¢; SSU6, 5¢-CGAATTCAGGGGCAACATCGGTTC-3¢;SSU7,5¢-CGAATTCACCGAGGTTACAAGGCA. ... °Cfor1h.RNaseH analysis A mix consisting of 6 lg RNA and 50 pmol oligo washeated in 1 · RNaseH buffer (GibcoBRL) at 80 °Cfor1min.At45°C, 20 U RNasin (Pharmacia) was added, and the sample incubated ... 5¢-CACTTCTAGAACCATGGTGAAAGGAACG-3¢;OP2,5¢-TGTCTGGATCCTCATCTG-3¢;OP4,5¢-TGTTGAAGTGCACAGATT-3¢;OP11, 5¢-GACTAGTTGACTTCTCACAGA-3¢; OP20,5¢-TTGAACACTTAATTGGGT-3¢;OP65,5¢-GGAGFig. 1. Homing endonuclease...
  • 9
  • 432
  • 0
báo cáo hóa học:

báo cáo hóa học:" Gene expression profiling for molecular distinction and characterization of laser captured primary lung cancers" ppt

... covering 8793 genes, and stained according to themanufacturer's instructions.Quantification, normalization and statistical analysisThe quality control, normalization and data analysis, ... signal-to-noise ratio, which areused as a training set in a training series. A training seriesgenerates a number of classifiers. After each series, the 30best resulting classifiers are applied ... SCLC, as well as normal lung tissue, a genetic programming data analysis was performed. Thepercentages of exact predictions for all samples of a classRANBP1 RAN binding protein 1 3.23 0.37MAF...
  • 17
  • 662
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Copy number and gene expression differences between African American and Caucasian American prostate cancer" docx

... expression profiles in a cohort of AA and CA PCapatients using BAC-based array comparative genomichybridization (aCGH), oligo-based aCGH, and gene expression array. Our goal was to identify AA/CA-spe-cific ... of African American and Caucasian American patients and tumors utilized for BAC-based DNA copy number analysis and gene expression profilingAfrican American(n = 20)Caucasian American(n = ... (PCa) in African American (AA) compared to Caucasian American (CA) patients using a genome-wide approach.Methods: AA and CA patients treated with radical prostatectomy (RP) were frequency matched...
  • 9
  • 372
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " LEF-1 and TCF4 expression correlate inversely with survival in colorectal cancer" pptx

... clinical data of patients and performed statistical data analysis. AJ and TK coordinatedthe study and were involved in drafting the manuscript and revised itcritically. All authors read and approved ... one of theleading causes of cancer- related death. Dysregulation and abnormal activation of the Wnt/b-catenin signallingpathway caused by mutations of APC are decisive forthe initiation as well ... by an activation of the canonical Wnt signalling pathway,which promotes the expression of multiple target genes mediating proliferation inavasion and invasion. Uponactivation of the Wnt signalling...
  • 8
  • 664
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " High expression of transcriptional coactivator p300 correlates with aggressive features and poor prognosis of hepatocellular carcinoma" doc

... K, Yamakawa M, Semba S, Takeda H, Kawata S, Kimura S,Kimura W: Expression of HDAC1 and CBP/p300 in human colorectalcarcinomas. J Clin Pathol 2007, 60:1205-1210.22. Karamouzis MV, Konstantinopoulos ... differentiation,stage,vascularinvasion and relapse were detailed in Table 1. Tumor differ entia-tion was based on the criteria proposed by Edmonson and Steiner [16]. Tumor stage was defined according ... multivariate analysis of different prognostic factors in 123 patients with hepatocellularcarcinoma (Cox Proportional Hazards Regression)Univariate analysis Multivariate analysisVariable All cases...
  • 11
  • 425
  • 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... TGGCCAGATCTAAAAAAGAGGT2fw ATCCCAGGAAACACCAGTAGA10rev ATTGTTTTCTCTCAAGACCCAATaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG18Sfw CGCCGCTAGAGGTGAAATTC18Srev TCTTGGCAAATGCTTTCGCTTaqMan probe 18S TGGACCGGCGCAAGACGGACABFig. ... rev,reverse.SequenceACMSD cloning: primer1fw CGCTCGAGATGAAAATTGACATCCATAGTCAT11rev AAAGCTGAGCTCCATTCAAATTGTTTTCTCTCAAG4fw TTCTCGAGATGGGAAAGTCTTCAGAGTGGTACMSD real-time PCR: primer and probe1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT2fw ... Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H & Shibata K (2002) Identifica-tion and expression of a cDNA encoding human a- amino-b-carboxymuconate-e-semialdehyde decarboxy-lase...
  • 14
  • 601
  • 0
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

... ON357, 5¢-TGAAACATCACCAACTAAATCTCCAA-3¢; ON358, 5¢-GACGACTCCATTGTTATAGGAAAAGAGT-3¢; ON359, 5 ¢-GCCGCTGGAGAAACAGCAT-3¢; ON360, 5¢-GCCACCCATTCGTCACAATC-3¢; and ON361, 5¢-ATGCAGAAGGGGATCCGG-3¢.Direct ... inducethe activation of intracellular cascades such as themitogen-activated protein (MAP) kinase – also calledextracellular signal-regulated kinase (ERK) – cascade.The serine ⁄ threonine kinases ... through a cascade thatincludes the proline-rich tyrosine kinase, Pyk2, Src and Grb2 [4,5], as well as Ras GEFs of the Ras-GRP (cal-DAG-GEF) family, through binding of Ca2+⁄ calmo-dulin (CaM) and...
  • 13
  • 730
  • 0
Tài liệu Báo cáo Y học: Regulated expression and intracellular localization of cystatin F in human U937 cells pptx

Tài liệu Báo cáo Y học: Regulated expression and intracellular localization of cystatin F in human U937 cells pptx

... promoterTGA AGC TGG AAA CCA TCA TTC AAA ACA TTA GCA GGA ATT TTC 52 343Lower promoter GGA GTT CTG CCA GGG AAC CAC GAC AGG GGA GAA CGC CAC TTA 57 587Exon 1 GTG CTG CCT GAG AAG GAT TG GAA AGT GCC ... cystatin F and ER the stainingwas performed on cells cultured for 2 days. Cystatin F wasstained as described above and after the last washing step20 lgÆmL)1Texas Red conjugated concanavalin A (Molecular ... rocking table. Followingincubation the Sepharose gel from 1 mL of mixture wasallowed to sink and the supernatant was discarded. Samplebuffer containing SDS and reducing agent was added and proteins...
  • 10
  • 536
  • 0
Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx

Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx

... majus, Bromhaedia finlaysonia, Arabidopsis thaliana, Persea americana,Ipomea purpurea, Ipomea nil and Medicago sativa), three anthocyanidin synthases (Zea mays, Anthirrhinum majus and Oryza sativa), ... origin, catalyze reactions of medicinal and industrial relevance, and their spatial organization and mode of action are under investigation. The reactions arediverse, such as the desaturation of ... Oryza sativa), five gibberellinC20 oxidases (Arabidopsis thaliana, Cucurbita maxima, Pisum sativum, Spinacia oleracea and Marah macrocarpa), hyoscyamine 6b-hydroxylasefrom Hyoscyamus niger,...
  • 9
  • 864
  • 0

Xem thêm

Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015