báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf

báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf

báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf

... sepsis when analyzed sepa- rately as well as analyzed as a haplotype. Especially in the sub group of patients ≤60 years old and in patients with non-abdominal and non-pulmonary sepsis focus the association ... respectively. Table 4 indicates the association of the carriage of the -173 C allele and the -794 CATT 7 allele with fatal outcome in patients with...
Ngày tải lên : 18/06/2014, 15:20
  • 8
  • 554
  • 0
báo cáo hóa học:" Sperm protein 17 is expressed in the sperm fibrous sheath" ppt

báo cáo hóa học:" Sperm protein 17 is expressed in the sperm fibrous sheath" ppt

... francesco.costa@uinimi.it; Fabio Grizzi - fabio.grizzi@humanitas.it; Barbara Franceschini - barbara.franceschini@humanitas.it; Elena Albani - elna.albani@humanitas.it; Paolo E Levi- Setti - paolo.levisetti@humanitas.it; ... Norris Comprehensive Cancer Center, University of Southern California, Los Angeles, CA, USA and 12 Cancer Research Center of Hawaii, University of Hawaii at Manao...
Ngày tải lên : 18/06/2014, 15:20
  • 5
  • 435
  • 0
báo cáo hóa học: " Discrimination and reliability: equal partners? Understanding the role of discriminative instruments in HRQoL research: can Ferguson''''s Delta help? A response" pptx

báo cáo hóa học: " Discrimination and reliability: equal partners? Understanding the role of discriminative instruments in HRQoL research: can Ferguson''''s Delta help? A response" pptx

... UK Email: Matthew Hankins - matthew.hankins@kcl.ac.uk Abstract A response to Norman GR 'Discrimination and reliability: equal partners?' and Wyrwich KW 'Understanding the role of discriminative ... and relia- bility as givens; it is assumed that anyone interested in the discrimination of an instrument has already established that the instrument is reliable and v...
Ngày tải lên : 18/06/2014, 19:20
  • 3
  • 384
  • 0
báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc

báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc

... Gonzalez I, Dejean S, Martin P, Baccini A: CCA: An R Package to Extend CanonicalCorrelation Analysis. Journal of Statistical Soft- ware 2008, 23(12):1-14. 64. Takakura S, Mitsutake N, Nakashima ... conducted all experiments for the paper, collected and analyzed the data and wrote the manuscript. PJ carried out data analyses and assisted with writing the manuscript. EW designed t...
Ngày tải lên : 18/06/2014, 15:20
  • 17
  • 593
  • 0
báo cáo hóa học: "Bayesian aggregation versus majority vote in the characterization of non-specific arm pain based on quantitative needle electromyography" pot

báo cáo hóa học: "Bayesian aggregation versus majority vote in the characterization of non-specific arm pain based on quantitative needle electromyography" pot

... in a full covariance matrix. To that end, the columns marked ψ show the coeffi- cient of variation, which is the ratio of the standard deviation of the mean of a feature versus the mean variability ... individual MUPT characteriza- tions have a maximum conditional pro bability that matches the true muscle characterization. An analysis of the same underlying d...
Ngày tải lên : 19/06/2014, 08:20
  • 12
  • 555
  • 0
báo cáo hóa học:" Angiostatin anti-angiogenesis requires IL-12: The innate immune system as a key target" docx

báo cáo hóa học:" Angiostatin anti-angiogenesis requires IL-12: The innate immune system as a key target" docx

... p40 0 1 2 3 4 5 0.00 0.01 0.02 AST Control AST/Mat Mat AST Control AST/Mat Mat AST Control AST/Mat Mat Relative expressionRelative expression AST/Mat AST/Mat AST/Mat AST Control Mat AST Control Mat AST Control Mat 0.000 0.005 0.010 0.015 0.8 1.0 Journal ... Inhibition of plaque neovascularization reduces macrophage accumulation and progression of advanced atherosclerosis. Proc...
Ngày tải lên : 18/06/2014, 15:20
  • 8
  • 477
  • 0
Tài liệu Báo cáo khoa học: Olfactory receptor signaling is regulated by the post-synaptic density 95, Drosophila discs large, zona-occludens 1 (PDZ) scaffold multi-PDZ domain protein 1 pptx

Tài liệu Báo cáo khoa học: Olfactory receptor signaling is regulated by the post-synaptic density 95, Drosophila discs large, zona-occludens 1 (PDZ) scaffold multi-PDZ domain protein 1 pptx

... 5¢-AAGCTAAGAGGCA CGGAACA-3¢,5¢-TCCTTATTGCCAGCGAGACT-3¢ (Patj), 5¢-TTGCAGACGGAAGAGGTTCT-3¢,5¢-GGCCACTT TCAGCATCAAAT-3¢ (Erbin), 5¢-GCGGATCCGCAT GTTGGAAACCATAGAC-3¢ and 5¢-GCGAATTCGA CATTTTTAGTGAGTTCCAC-3¢ ... was extracted from adult mouse olfactory epithelium, and the primers were used were: 5¢-CAAAACGCTCTACAGGC TCC-3¢,5¢-GAAGAGCTGGACAGAGGTGG-3¢ (ZO-1), 5¢-TTATGGGCCACCGGATATTA-3¢,5¢-GGAGAGT...
Ngày tải lên : 18/02/2014, 13:20
  • 12
  • 543
  • 0
Báo cáo khoa học: Androgen receptor function is modulated by the tissue-specific AR45 variant ppt

Báo cáo khoa học: Androgen receptor function is modulated by the tissue-specific AR45 variant ppt

... action. Results Identification of AR45, a novel variant of the human AR 5¢ Rapid amplification of cDNA ends (RACE) was performed on human placental RNA using a reverse primer directed against the hinge domain of the AR and ... (Strata- gene). The following primers were used for AR45: 5¢-ACA GGGAACCAGGGAAACGAATGCAGAGTGCTCCTGA CATTGCCTGT-3¢ and 5¢-TCACTGGGTGTGGAAATA GATGGGCTTG...
Ngày tải lên : 07/03/2014, 16:20
  • 11
  • 514
  • 0
Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

... Shilatifard A (2001) COMPASS: a complex of proteins associated with a trithorax-related SET domain protein. Proc Natl Acad Sci USA 98, 12902–12907. 9 Tenney K & Shilatifard A (2005) A COMPASS ... KS, Carlone DL, Jacobsen BM, Flodin A & Skalnik DG (2000) Cloning of a mammalian transcrip- tional activator that binds unmethylated CpG motifs and shares a CXXC domai...
Ngày tải lên : 07/03/2014, 21:20
  • 7
  • 658
  • 0
Báo cáo khoa học: b-Secretase cleavage is not required for generation of the intracellular C-terminal domain of the amyloid precursor family of proteins pot

Báo cáo khoa học: b-Secretase cleavage is not required for generation of the intracellular C-terminal domain of the amyloid precursor family of proteins pot

... [43,53,54]. This characterization of BACE1 effects on APP, APLP1 and APLP2 has highlighted the fact that APP and APLP2 share many similarities, whereas APLP1 b-Secretase processing of APLP1 and APLP2 ... suggests that there is a discrete pool of FLAPP that is directed towards processing, and that a- secretases and b-secretases have access to the same cellular pool. For APLP1,...
Ngày tải lên : 15/03/2014, 10:20
  • 16
  • 549
  • 0

Xem thêm

Từ khóa: