The Reverse Logistics Process in the Supply Chain and Managing Its Implementation
The Reverse Logistics Process in the Supply Chain and Managing Its Implementation
... processing delays in the reverse logistics process. This is a main reason that reverse logistics processes and their management have increased in importance within the business community and ... logistics and product returns can assist in identifying areas in 2 supply chain management and manufacturing where changes in the reverse logistics process might be needed. Therefore, maintaining ... in an attempt to rein in costs and streamline the process. It is this reason that field of reverse logistics has increased in importance within the business community and academia (Carter and...
- 149
- 558
- 0
Tài liệu The impact of timely information on organisational performance in a supply chain
... throughout the supply chain. 4. Identifying and participating in additional supply chains.5. Establishing more frequent contact with supply chain members.6. Involving all supply chain members in your ... b, Brox and Fader 2002, Kinney and Wempe 2002, Green and Inman 2005).Considering that waste is eliminated from the information generat ing processes within the supply chain, Stratman and Roth ... necessary for the required sharing of information across the entire supply chain. Implementation of supply chain manage-ment strategies requires that organisations within supply chains mutually and openly...
- 10
- 621
- 0
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater
... Figure 4. Band intensities for Nitrobacter species While in Figure 4, the band intensities were high only in Runs 5 and 7, and their band intensities were quite similar, PCR method in general ... sedimentation tank. Influent was 60L/day. pH was 8.0-8.5 in the anoxic tank, and 7.0-7.5 in the aerobic tank. The water temperature was 25oC-30oC. The sludge retention time (SRT) was maintained at ... instruction by the manufacturer. In the preliminary step to nawwor down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995)...
- 8
- 572
- 0
Domestic Wastewater Reclamation Coupled with Biofuel/Biomass Production Based on Microalgae: A Novel Wastewater Treatment Process in the Future
... and the downstream process to produce biofuel are the key points of the novel process, which determine the wastewater treatment efficiency and the net energy production of the whole process. Therefore, ... for the coupled system In the novel process being proposed, the proper selection of microalgal species is the foundation and key point of the microalgal cultivation unit. Considering the inorganic ... The A2O process is omitted, and the inorganic nutrients are used to cultivate microalgae, which can be further processed to obtain biodiesel and other biofuels. (3) With CCS technique and...
- 9
- 762
- 0
Tài liệu Implementation of the Asthma Practice Guideline in the Army Medical Department - Evaluation of Process and Effects pdf
... change in MTFs by addressing two main dimen-sions: building local ownership or “buy -in from the staff responsiblefor implementing the new practices and ensuring that clinical and administrative ... influence how successful anMTF will be in integrating new practices into its clinical and admin-istrative processes. We assess here the extent to which MTFs in thisdemonstration realized these ... clinical practices.By the time the asthma guideline demonstration began,MEDCOM had expanded its staffing and other resources, and weobserved its staff providing regular policy guidance and...
- 212
- 442
- 0
Tài liệu THE BOOK SELECTION PROCESS FOR THE BOOK CITATION INDEX IN WEB OF SCIENCE pdf
... conference proceedings literature in its Conference Proceedings Citation Index (1990 to present). These indexes are characterized by the quality of the publications covered in them. Their content ... employing well-defined selection criteria in a systematic and consistent manner. With the inclusion of The Book Citation Index in Web of Science, Thomson Reuters has expanded the scope of its ... cited book series in Science, Social Science, and Arts & Humanities. Journal and proceedings citations to books in these series indicate that they are well-integrated into the scholarly communication...
- 4
- 477
- 0
Measurement of the underlying event in the Drell–Yan process in proton–proton collisions at √ s =7 TeV pptx
... matterdistribution of the hadrons in impact-parameter space. The MPI model used here [26] includes showering of the MPI process, which is interleaved with the ISR. The tunes of the models vary mainly in the MPI ... and ρ is the average energy density [34]inthecalorimeter and tracker originating from additional inelasticpp interactions (pile-up) in the same bunch crossing as the DY interaction .The calculation ... and pseudorapidity |η|< 2. The particle and en-ergy densities are corrected using a bin-by-bin technique. In the bin-by-bin technique, the correction factor is calculatedby taking the bin-by-bin...
- 24
- 493
- 0
Báo cáo khoa học: Mechanism of the ring contraction process in vitamin B12 biosynthesis by the anaerobe Propionibacterium shermanii under aerobic conditions docx
... postulated mechanisms of the ring contraction process in the biosynthesis of vitamin B12 in the anaerobeP. shermanii (top row) and the aerobe P. denitrificans (lower row) obtained by previous [1-13C,1,1,4-18O3]ALA ... anaerobically cultivated in phosphateFig. 2. The mechanisms of the ring contraction process in the biosynthesis of vitamin B12postulated on the basis of the isolation of factor IVfrom the anaerobe P. ... ringcontraction involves the migration of ring A after for-mation of the d-lactone from the ring A acetate groupto C20, following the methylation of Co-precorrin-3 atC17 [6,7]. In the aerobe Pseudomonas...
- 7
- 443
- 0
Cambridge.University.Press.The.Crisis.of.Literature.in.the.1790s.Print.Culture.and.the.Public.Sphere.Nov.1999.pdf
... excavate the cultural institutions, the competi-tive readings, the social and political constraints, and above all, the intense mutualities and struggles in social space that guide and block the ... of their mix of promise and threat, anticipation and dread,resound in the writings of the eighteenth and early nineteenth centuries in Britain – a time and a place when the newly disturbing ... that the French ‘revolutionaries knew what they were doing when they car-ried printing presses in their civic processions and when they setaside one day in the revolutionary calendar for the...
- 316
- 972
- 2
The Art of Building in the Classical World
... ofscale drawing in the organization of architectural space beginning in the Clas-sical period (479–323 b.c.). In this exploration, I approach the Greek theatron – the “place for seeing” – as the earliest ... of the Hellenistic period in particu-lar. A defining feature of Hellenistic art is the extension of dynamism inherent in the work itself to the viewer’s interaction with the work. As seen in the bronze ... definition in the writing ofVitruvius. The ownership of graphic construction as the domain of cogitatio(analysis) and inventio (invention) for the shaping of space according to goodform and number...
- 263
- 489
- 1
Từ khóa: logistics and the supply chainlogistics and the supply chain management2enablers of sustainability in the supply chainrole in the supply chainstrengthening the supply chainconfronting challenges to the supply chain for second line drugsthe supply chain water footprint per business unitthe supply chain water footprint for the businesssteelcase streamlining the supply chainsupply chain and machinery management issues and a summary of the constraints encounteredubiquitous communication tracking technologies within the supply chainsecuring the supply chainlean supply chain and logistics management downloadmodels the value chain and generic distinctive competenciesthe mirrae chain and aluminumchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ