Báo cáo khoa học: NMR and MS evidences for a random assembled O-speciﬁc chain structure in the LPS of the bacterium Xanthomonas campestris pv Vitians A case of unsystematic biosynthetic polymerization potx

Báo cáo khoa học: NMR and MS evidences for a random assembled O-speciﬁc chain structure in the LPS of the bacterium Xanthomonas campestris pv. Vitians A case of unsystematic biosynthetic polymerization potx

... (B ¼ b-Rha, A ¼ a- Rha, A ¼ a- Fuc3NAc (1ﬁ2) a- Rha)B A, B– A B A A, B A A, B A A, B A A B A A A, B A A A, B A A A, B A A A, B A A A, B– A A A, B A A A, B A A A Several of these combinations were ... NMR and MS evidences for a random assembled O-speciﬁc chain structure in the LPS of the bacterium Xanthomonas campestris pv. Vitians A case of unsystematic biosynthetic polymerization Antonio ... 50 A ˚ for 500 ps and with a step length of 1 fs. Full coordinates were saved every2.5 ps. Among the structures modelled were A A B A A B A A, A A B A A B A A, A A B A AvB A A and A A B– A A B A A...

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

... highly variable C-terminal domain after the terminal conserved arginine of the cytoplasmic serine ⁄threonine kinase domain. Sequences for phylogenetic rela-tionships of the extracellular part were ... housekeeping gene by using the formulaN ¼ 1 · 2(Ct GAPDH – Ct target).Zebraﬁsh maintenance and preparation of eggsTAB zebraﬁsh were reared and maintained on a light ⁄ darkcycle essentially as described ... JQ & Martindale MQ (1996) Dualorigins of mesoderm in a basal spiralian: cell lineageanalyses in the polyclad turbellarian Hoploplana inqui-lina. Dev Biol 179, 329–338.48 Lambert JD &...

Báo cáo khoa học: NMR and molecular dynamics studies of an autoimmune myelin basic protein peptide and its antagonist Structural implications for the MHC II (I-Au)–peptide complex from docking calculations ppt

... Ala81 far distantfrom the side chain of Arg78. The side chain of Arg78 is lesswell deﬁned, as in the case of aqueous solution, because of the absence of interactions with the s ide chains of ... structuralimportance of the nature o f the amino acid at position 81 of the encephalitogenic sequence 74–85 of guinea MBP:replacement of Asp81 with an alanine seems to break a chain of electrostatic interactions, ... segment.Fig. S3. (A) Average number of hydrogen bonds of the s ide chain of Arg78 for the agonist and t he antagonist in water and Me2SO solutions. (B) Average solvent-accessible sur-face area (ASA).Fig....

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... monoclinic and orthorhombic formsusing the program align [7] gave an rmsd of 0.54 A ˚between corresponding Ca atoms. The variation waslarger with respect to the C-domain, which gave anrmsd of ... templateusing Deep Vent DNA polymerase (New England Biolabs,Ipswich, MA, USA), a sense primer (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) ... Billerica, MA, USA).Initial characterization of the protein The purity and molecular mass of the protein were checkedby 12% SDS ⁄ PAGE and MALDI-TOF MS. Gel-permeationchromatography with 200 lLofa1mgÆmL)1protein...

Tài liệu Báo cáo khoa học: "Syntactic and Semantic Kernels for Short Text Pair Categorization" docx

... divided the training (TREC) data in 9 bins of increasing size (200 instances between two con-tiguous bins) and we measured the learning and test time5 for each bin. Figure 5 shows that in both the ... Roth,2005). Each question is paired with all the top20 answer paragraphs extracted by two basic QAsystems: one trained with the web documents and the other trained with the AQUAINT data used in TREC’07. The ... productions at n1 and n2are the same, and n1 and n2have only leaf children (i.e. theyare pre-terminal symbols) then ∆(n1,n2)=λ;3. if the productions at n1 and n2are the same, and n1and...

Báo cáo khoa học: Sirt1 and mir-9 expression is regulated during glucose-stimulated insulin secretion in pancreatic b-islets ppt

... mechanismsmay help in the understanding and tackling of diseasessuch as diabetes.Experimental proceduresAnimal experimentsAdult Swiss male mice were maintained at the Tata Insti-tute of Fundamental ... Sirt1 and mir-9 expression is regulated duringglucose-stimulated insulin secretion in pancreatic b-isletsDeepti Ramachandran*, Upasana Roy*, Swati Garg, Sanchari Ghosh, Sulabha Pathak and Ullas ... (AgilentTechnologies, Santa Clara, CA, USA cat. no. 219020)according to the manufacturer’s instructions. Luciferaseactivities were normalized to the b-galactosidase activity in each case. Western blotsEqual amounts...

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

... 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢R11 4A 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢Y116D 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢Y. ... Chaperones 8, 381–394.70 Rajaraman K, Raman B, Ramakrishna T & Rao CM(2001) Interaction of human recombinant aA- and aB-crystallins with early and late unfolding intermedi-ates of citrate ... (2001) The expanding family of Arabidopsis thaliana small heatstress proteins and a new family of proteins containing a- crystallin domains (Acd proteins). Cell Stress Chaper-ones 6, 225–237.9 Narberhaus...

Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

... FEBSproviding a rationale for the use of combinations of MEK1 ⁄ 2 inhibitors and PI3K–PKB pathway inhibitors.Indeed, rapamycin, an inhibitor of mammalian target of rapamycin (mTOR) downstream of PKB, ... several signalling pathways, includ-ing the ERK1 ⁄ 2 pathway, the PKB pathway and the Janus kinase ⁄ signal transducer and activator of tran-scription (JAK-STAT) pathway, to promote prolifera-tion, ... pathways they control; in all casesinhibition of the oncogenic kinase results in the loss of downstream survival signalling pathways and a consequent increase in the expres-sion of BIM. Inactivation...

Báo cáo khoa học: "Extracting and modeling durations for habits and events from Twitter" doc

... durations is crucial to any natural language processing task in- volving temporal understanding and reasoning. This information comes in many forms, among them knowledge about typical durations ... durations has been com-piled and made available. This automati-cally generated duration information is broadly comparable to hand-annotation.1 IntroductionImplicit information about temporal ... and (2) and classifying these as to whether they re-ferred to specific event (as in (1)) or a general habit (as in (2)), then summarizing the duration informa-tion associated with each kind...

Báo cáo khoa học: "Local and Global Algorithms for Disambiguation to Wikipedia" pot

... TrainingWe train the coefﬁcients for the ranker features us-ing a linear Ranking Support Vector Machine, usingtraining data gathered from Wikipedia. Wikipedialinks are considered gold-standard ... gold-standard links for the training process. The methods for compiling the Wikipedia training corpus are given in Section 5.We train the linker as a separate linear SupportVector Machine. Training ... results in at least a 10% rankererror rate. 40 paragraphs of this data was utilized for testing, while the remainder was used for training. The data sets are summarized in Table 2. The ta-ble...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Chuong 2 nhận dạng rui ro Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP