Báo cáo khoa học: Swollenin, a Trichoderma reesei protein with sequence similarity to the plant expansins, exhibits disruption activity on cellulosic materials pptx
... sequence similarity to
the plant expansins, exhibits disruption activity on cellulosic materials
Markku Saloheimo
1
, Marja Paloheimo
1
, Satu Hakola
1
, Jaakko Pere
1
, Barbara Swanson
2
, Eini ... of the enzyme to the insoluble
substrate.
In addition to plants, a protein with an endoglucanase
domain and a domain with sequence similarity to exp...
... imperfect.
The question then arose as to whether it would
be better to treat these variables as binary or con-
tinuous. Theoretical justifications for a binary pa-
rameterisation lie in the fact that a ... computational models, leading current re-
searchers to continue to use the classic semantic
and grammatical variables, enhancing them with
NLP techniques.
Because this re...
... antimicrobial assay
and in planta studies demonstrated that NtKTI1 is an
antifungal protein that increases the resistance of
tobacco to fungal attack.
Results
Isolation and characterization of a cDNA encod-
ing ... Planta 183,
528–535.
27 Yamagata H, Kunimatsu K, Kamasaka H, Kuramoto
T & Iwasaki T (1998) Rice biofunctional alpha-amy-
lase ⁄ subtilisin inhibitor: characterization,...
... Introduction
Supertagging is based on the combination of two
powerful and influential ideas of natural language
processing: On the one hand, parsing is (at least
partially) reduced to a decision on the ... important) constraints is always preferred.
All knowledge about grammatical rules is encoded
in the constraints that (together with the lexicon)
constitute the gramma...
... Model-Refinement to adjust
this so-called bias. The basic idea is to take
advantage of misclassified examples in the
training data to iteratively refine and adjust
the centroids of text data. The experimental ... such
as Naïve Bayes (Sebastiani 2002), can then be
applied to learn each of these L problems. L can
then be thought of as the length of the codewords
81
1...
... the parser’s syntactic
constituents into logical grammatical relations
(GLARF), and then extracted the 5Ws from the
logical form. As a back-up, it also extracted
GLARF relations from another ... where evaluation is done on translated
results in the target language. In cross-lingual
information extraction (Sudo et al. 2004) the
evaluation is also done on MT, but the go...
... automated in-
put to a data base. The long-term goal of the work
described is to develop a support technology for spe-
cific analytical functions related to the evaluation
of daily message traffic ... UNDERSTANDING PROCESS
The formal definition of the sublanguage currently
takes the form of an ATN grammar. The parser takes a
sentence as input and produces a p...
... 263
not select at all, or not as fast, for one desired
microbial property as an auxostat. In contrast to nat-
ural habitats, an auxostat provides a monoculture
with a constant selection parameter, i.e. ... simulation started with the assumption that the yeast popula-
tion contained cells with a variety of maximum growth rates, all
normally distributed around the measured a...
... (5¢-AAA
CCGCGGCAATGAAAAAG
TTATTAGTCAAGGAG) and SH3 (5¢-AAA
GGATCC
GGTCTGCTACTAACACTAGGATTCATC). The PCR
fragments were cut with SacII and BamHI and cloned into
pGP172 linearized with the same enzymes. The ... lLmixturewastransferredtoafreshreactiontubeandthereaction
was stopped (96 °C, 4 min). The fractions were then separated on a
native polyacrylamide gel, analyzed using th...