0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: The influence of temperature and osmolyte on the catalytic cycle of cytochrome c oxidase ppt

Báo cáo khoa học: The influence of temperature and osmolyte on the catalytic cycle of cytochrome c oxidase ppt

Báo cáo khoa học: The influence of temperature and osmolyte on the catalytic cycle of cytochrome c oxidase ppt

... concentrations of cytochrome c plus TMPD and ascorbate. As the concen-tration of cytochrome c is increased, the fraction of cytochrome a that is reduced increases. The fraction of cytochrome a ... second catalytic cycle of reduction of CCO by cytochrome c. Mitchell and Rich [47] proposed that two protons weretaken up on reduction of CCO and that these were taken upconcomitantly with reduction ... The influence of temperature and osmolyte on the catalytic cycle of cytochrome c oxidase Jack A. Kornblatt1, Bruce C. Hill2 and Michael C. Marden31Enzyme Research Group, Concordia...
  • 8
  • 343
  • 0
Báo cáo khoa học: Nerve influence on myosin light chain phosphorylation in slow and fast skeletal muscles pdf

Báo cáo khoa học: Nerve influence on myosin light chain phosphorylation in slow and fast skeletal muscles pdf

... decrease of mass)when compared with the corresponding muscles of the control animals (CONT) or with the muscles of the controlateral unoperated limb (CODE). The distribution of MHC and MLC isoforms ... low-frequency stimulation; COCsA, controls for CsAreceiving cremophor A solution only; CODE, controlateral unoperated limb; CONT, control; CsA, cyclosporin A; ECL, enhancedchemiluminescence; EDL, extensor ... basic on the left to acidic on the right. Mr and isoelectric point labels are placed on the upper and left edge of the MLC region. (B) Immunoblotting for the detection of MLC kinase, PP1 and actin...
  • 15
  • 288
  • 0
Báo cáo khóa học: CD38 is expressed as noncovalently associated homodimers on the surface of murine B lymphocytes doc

Báo cáo khóa học: CD38 is expressed as noncovalently associated homodimers on the surface of murine B lymphocytes doc

... primer 1: 5¢-(GACATCTTCCTCGagCGCTGCCTCATC)-3¢; CD38-G68E, primer 2:5¢-(CCCTCTAGACCAGATCCTTCACGTATTAAGTCTACACG)-3¢; CD38-G68E, primer 3: 5¢-(GATGAGGCAGCGCTCGagGAAGATGTC)-3¢; CD38-G68E, primer4: ... areindicated in lower case italics: CD38-E150L, primer 1:5¢-(TACTTGGATCCAGGGAAAGATGTTCACCCTGctGGACACCCTG)-3¢; CD38-E150L, primer 2: 5¢-(CC C TCTAGACCAGATCCTTCACGTATTAAGTCTACACG)-3¢; CD38-G68E, primer ... eutha-nized by CO2narcosis in accordance with the recommenda-tions of the Panel on Euthanasia of the AVMA and incompliance with the CINVESTAV and Trudeau InstituteIACUC guidelines. The IL-3 dependent...
  • 10
  • 448
  • 0
Báo cáo khoa học: Plasmodium falciparum hypoxanthine guanine phosphoribosyltransferase Stability studies on the product-activated enzyme potx

Báo cáo khoa học: Plasmodium falciparum hypoxanthine guanine phosphoribosyltransferase Stability studies on the product-activated enzyme potx

... exert their action,at high concentrations, as nonspeci c polyanionsblocking merozite invasion of the erythrocyte [10–13].HGPRT is also of importance to the host, with the absence and the deficiency ... activity of the fully activa-ted enzyme, and the value obtained for the enzymeimmediately after purification as the speci c activity of the unactivated enzyme. The ratio of the concentration of the ... absorbance from the ligand carried over (< 0.48 lm) into the assay togetherwith the activated enzyme would not affect the speci c activities presented. The presence of ligands at theseconcentrations...
  • 12
  • 308
  • 0
Báo cáo khoa học: Multifunctional host defense peptides: functional and mechanistic insights from NMR structures of potent antimicrobial peptides docx

Báo cáo khoa học: Multifunctional host defense peptides: functional and mechanistic insights from NMR structures of potent antimicrobial peptides docx

... orientation without the need forinsertion into the hydrophobic region of the bilayer. On the other hand, the presence of cholesterol reduced the tilt of the MSI-594 helix to within 5° and that of the ... multilamellarvesicles was used to determine the backbone conforma-tion and the membrane orientation of MSI peptides.Solid-state NMR experiments on lipid vesiclesconfirmed the helical conformation of these ... number of bacterial species, including Mycobacte-rium tuberculosis, Enterococcus faecium, Klebsiella pneu-moniae, Staphylococcus aureus, Pseudomonas aeruginosa and Streptococcus pneumoniae from...
  • 9
  • 277
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Mention-Synchronous Coreference Resolution Algorithm Based on the Bell Tree" potx

... check the gender consistency when considering the active mention “she”.3.3 DiscussionThere is an in-focus entity in the condition of the link-ing model (1) while the starting model (2) conditions on ... 1995) and ECM-F. The MUC score counts the common links be-tween the reference and the system output.5.2 Results on the ACE data The system is first developed and tested using the ACEdata. The ACE ... 2003) compute directly the probabil-ity of an entity configuration conditioned on mentions, and it is not clear how the models can be factored todo the incremental search, as it is impractical...
  • 8
  • 403
  • 0
Tài liệu Báo cáo khóa học: Mutations in the hydrophobic core and in the protein–RNA interface affect the packing and stability of icosahedral viruses doc

Tài liệu Báo cáo khóa học: Mutations in the hydrophobic core and in the protein–RNA interface affect the packing and stability of icosahedral viruses doc

... could not be determined because of the lack of change induced by pressure.Changes in secondary structure upon dissociation and denaturationTo further confirm the urea-induced changes in secondarystructure, ... scattering and spectral center of mass measurements of WT MS2 as a function of urea concentration. To verify the dissociation and denaturation processes, we measured the light scattering of the ... secondarystructure, we analyzed the UV CD spectra of MS2 and the tsmutants in the presence and absence of 4.5Murea, the concentration at which the greatest difference among the various samples...
  • 11
  • 609
  • 0
Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt

Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt

... AGTTCA –Acyl-CoA oxidase A AGGACA a AGGTCA [54]Acyl-CoA oxidase B AGGTAG a AGGTCA [54]Lipoprotein Lipase TGCCCT t TCCCCC [58]Apolipoprotein AII CAACCT t TACCCT [68]Enoyl-CoA hydratase GACCTA ... (5¢-dCAACCTTCAATGCCCCAGCCTAAATATCCTCTCCGGT-3¢;antisense primer) to generate pGL3b:Prm3abPPARc(a)*.Mutation of the consensus retinoic acid X responsiveelement (RXR) half site with the sequence ... hydratase GACCTA tt GAACTA t TACCTA [69]3-Ketoacyl-CoA thiolase AGACCT t TGAACC [70]Perilipin TCACCT t TCACCC [71]A. T. Coyle et al. Effect of 15d-PGJ2 action on TP gene expressionFEBS Journal 272...
  • 20
  • 432
  • 0
Báo cáo khoa học: Mitochondrial transcription factor A overexpression and base excision repair deficiency in the inner ear of rats with D-galactose-induced aging pdf

Báo cáo khoa học: Mitochondrial transcription factor A overexpression and base excision repair deficiency in the inner ear of rats with D-galactose-induced aging pdf

... calculator(BioChrom, Cambridge, UK).Quantification of the mitochondrial commondeletion The proportion of the mitochondrial common deletion wasdetermined with a TaqMan real-time PCR assay. The Accumulation of ... forward and reverse primer, and 0.2 lLof10lm each probe. The ampli-fication conditions were as follows: one cycle of 30 s at95 C, and 40 cycles of 95 C for 5 s and 60 C for 30 s.Each DNA ... (Ctdeletion) CtD-loop) was used to calculate the abundance of the mitochondrial common deletion, and the proportion of deletion was calculated with the equationR =2)DCT· 100%.Mitochondrial...
  • 11
  • 450
  • 0
Báo cáo khoa học: Proteoglycans in health and disease: the multiple roles of syndecan shedding ppt

Báo cáo khoa học: Proteoglycans in health and disease: the multiple roles of syndecan shedding ppt

... units. The repeating unit of HS and chondroitin sulfate back-bones are glucuronic acid (GlcA)–N-acetylglucosamine(GlcNAc) or GlcA–N-acetylgalactosamine (GalNAc),respectively. These chains ... inhibition of cell invasion [92]. How-ever, the mechanism remains unknown.Integrins and syndecans together may influence the outcome of cell adhesion and migration because theirdifferent activation ... healing and menstrual endo-metrium. Under physiological conditions, the activity of MMPs is regulated by transcription, activation of the precursor zymogen and by interactions with spe-ci c extracellular...
  • 14
  • 469
  • 0

Xem thêm

Từ khóa: Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ