Báo cáo khoa học: "You Can’t Beat Frequency (Unless You Use Linguistic Knowledge) – A Qualitative Evaluation of Association Measures for Collocation and Term Extraction" pot

... Linguistics You Can’t Beat Frequency (Unless You Use Linguistic Knowledge) – A Qualitative Evaluation of Association Measures for Collocation and Term ExtractionJoachim Wermter Udo HahnJena University Language ... Chapter of the Association for Com-putational Linguistics, pages 18 8–1 95. Toulouse,France, July 9-11, 2001. San Francisco, CA: Mor-gan Kaufmann.Katerina T. Frantzi, Sophia Ananiadou, and HidekiMima. ... The Balancing Act: Combining Statistical and Symbolic Approaches to Language, pages 4 9– 66. Cambridge, MA: MIT Press.Stefan Evert and Brigitte Krenn. 2001. Methods for the qualitative evaluation...

Tài liệu Báo cáo khoa học: KCNE4 can co-associate with the IKs (KCNQ1–KCNE1) channel complex ppt

... understanding of the role of KCNE4 as a potentially important regulator of KCNQ1 and otherKVchannels.ResultsCharacterization of KCNE4 antibody A rabbit polyclonal antibody raised against a C-termi-nal ... inactivation behaviour of voltage-gated K-channels may be determined by association of alpha- and beta-subunits. J Physiol Paris88, 17 3–1 80.Supplementary materialThe following supplementary ... & Greger R (1999) Carbachol activates a K+channel of very small conductance in the basolater-al membrane of rat pancreatic acinar cells. PﬂugersArch 438, 59 7–6 03.34 Bleich M & Warth...

Báo cáo khoa học: Nanoparticles can induce changes in the intracellular metabolism of lipids without compromising cellular viability docx

... assays would expand the current platform of tests for thedetermination of the biocompatibility of nanomaterials.AbbreviationsDIV 8, day (in vitro) 8; FAS, fatty acid synthase; FFA, free fatty ... (Burlington,Canada); Oil Red O, Harris hematoxylin, polyornithine and laminine from Sigma (Oakville, Canada); formalinfrom Fisher Scientiﬁc (Nepean, Canada); Alamar bluereagent from Biosource (Montreal, ... Pathogenesis of lipodystrophy and lipid abnormalities in patients taking antiretroviraltherapy. AIDS Rev 9, 3–1 5.22 Li J, Bosch-Marce M, Nanayakkara A, Savransky V,Fried SK, Semenza GL &...

Báo cáo khoa học: "The Beneﬁt of Stochastic PP Attachment to a Rule-Based Parser" doc

... existence of learnt and handwritten grammars of natural languages. A great many formalisms have been advanced thatfall into either of the two variants, but even thebest of them cannot be said to ... guidethe parser when it has no other means of makingan attachment decision. Finally, the parser and grammar are freely available for use and modi-ﬁcation (http://nats-www.informatik.uni-hamburg.de/download).Weighted ... can make to the per-formance of a full parser for unrestricted text.The accuracy of PP attachment has rarely beenevaluated as a subtask of full parsing. (Merlo et al.,1997) evaluate the attachment...

Báo cáo khoa học: "EM Can Find Pretty Good HMM POS-Taggers (When Given a Good Start)∗" docx

... (and a morphological analyzer), and a fair amount of unlabeled training data, but hardlyany annotated corpora. We actually report resultson full morphological disambiguation for Hebrew, a task ... estimate the probability of a taggiven a context as the average probability of a taggiven any of the words appearing in that context, and similarly the probability of a tag given a word is theaveraged ... tag-word annotations). This small seedinitialization (InitTrans) has a great impact on ac-curacy. Overall, we reach 89.4% accuracy on fullmorphological and 92.4% accuracy for POS tagging and word...

Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

... mutants and GAL4-GRASP55revealed that, apart from the VP16-MT1 FFR(Fig. 5A, lane 3) and VP16-MT1 DKV mutants(Fig. 5A, lane 9), all the other triple mutants (Fig. 5A, lanes 4–8 ) displayed a marked ... Beznoussenko G,Savarese M, Marra P, Di Tullio G, Martire G, DeMatteis MA & Bonatti S (2009) GRASP65 and GRASP55 sequentially promote the transport of C-terminal valine-bearing cargos to and through ... Intracellular activation of gelatinase A (72-kDa type IV collagenase) by normal ﬁbroblasts.Proc Natl Acad Sci USA 94, 442 4–4 429.60 Deryugina EI, Ratnikov BI, Yu Q, Baciu PC, RozanovDV &...

Tài liệu Báo cáo khoa học: How disorder inﬂuences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

... N-terminalhexahistidine tag was obtained by PCR using thepET2 1a ⁄ PNT-H6plasmid [30] as the template. The forwardprimer (5¢-TACCGTTAACATCGATATGCATCATCATCATCATCATGC-3¢) was designed to insert a ClaI ... N-terminus was obtained by PCR from theplasmid pET21 ⁄ SIC1 [32] with a forward primer (5¢-TACCTGGCCAATGAATATGCATCATCATCATCATCATACTCCGTCGACCCCACC-3¢) designed to introduce a hexahistidine tag ... Spectra at 20 °C weremeasured in the range 18 5–2 60 nm for far-UV measures, 26 0–4 00 nm for near-UV measures and 40 0–7 50 nm for UV-visible measures, with 0.2 nm data pitch and 20 nmÆmin)1scanning...

Tài liệu Báo cáo khoa học: The Pseudomonas aeruginosa nirE gene encodes the S-adenosyl-L-methionine-dependent uroporphyrinogen III methyltransferase required for heme d1 biosynthesis doc

... NirE_Compl _for (GAGAATTCGGAAATCGGCCTCG) and NirE_Compl_rev (CTAAGCTTTCAGGCGCATGCG) for the nirE gene and CobA_Compl _for (GAGAATTCACTGCTGGCGGCC) and CobA_Compl_rev (CTAAGCTTTCAGGCGCTCAGGG) for ... recombinant NirE from Pseu-domonas aeruginosa and characterization of in vivo accumulatedtetrapyrroles. (A) SDS ⁄ PAGE analysis of the production and purifi-cation of recombinant NirE. Lane 1, ... lm) and HemD (0.17 lm). Alternatively, uroporphyrin III wasreduced chemically and used at a final concentration of 8 lm. The reaction was started by the addition of SAM to a final concentration of...

Tài liệu Báo cáo khóa học: The unusual methanogenic seryl-tRNA synthetase recognizes tRNASer species from all three kingdoms of life pptx

... tRNASer:SerRScomplexes (lanes 1 and 5, respectively) have a pI value of approximately 5.2.Dimerization of archaeal tRNA transcriptUnlike many other tRNAs, M. maripaludis and M. janna-schii tRNASerGCUtranscripts ... mMMgCl2before placing on ice. The amount of active tRNAwas determined by measuring aminoacylation plateau withhomologous SerRSs (at 37 °CforM. maripaludis and 55 °CforM. jannaschii). The acceptor activities ... heat denaturation of E. coli proteinswas performed, and after separation of M. jannaschi His-tagged SerRS by Ni–NTA afﬁnity chromatography, basicSerRS protein was additionally puriﬁed on a...

Tài liệu Báo cáo khoa học: Yeast glycogenin (Glg2p) produced in Escherichia coli is simultaneously glucosylated at two vicinal tyrosine residues but results in a reduced bacterial glycogen accumulation docx

... extracts were analy zed by H PAEC-PAD. As a standard, a commercial maltodextrin sample (Dextrin 15, Fluka, Germany) wasused. Data f rom a single e xperiment are shown. The maltod extrinpatterns ... U25436) 5¢-ATGGCCAAGAAAGTTGCCATCTGT; 3¢-TCAGGTATCAGGCTTTGGGAATGC. RT-PCR was performed using SSII R NaseH – RT (Invitrogen,Karlsruhe, Germany) and High Fidelity Expand Poly-merase (Roche, Mannheim, ... i.e. a mass of 28 Da. All y-type fragments contain theC-terminus of the p eptide. Many fragments show a satellitepeak at )17 Da. This peak is due to a loss of NH3,presumably from an asparagine...

Xem thêm