0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Identification of Domain-Specific Senses in a Machine-Readable Dictionary" potx

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

... CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT 259CD237904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG ... (5¢-to3¢)Size(bp)MDR1 GAAGAAGGGCCAGACGC CTCCTGGGACACGATGC 178MRP1 CCTTCGCTGAGTTCCTGC CTGCGGTGCTGTTGTGG 246BCRP ACATCAGCGGATACTACAGAG CACCATCATAAGGGTAAACAT 173CA9 TTTGAATGGGCGAGTGATTG ACAGCAAAAAGGAGGCCAAA 138BMP2 ... CTGATAGGGGTTGGGTGATG 128AK095731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC 109DKK1 CACCTTGGATGGGTATTCCA CAACACAATCCTGAGGCACA 114BC037851 CACAGCTCCCATTCATTCCA TCCCTTTGCCTCCTGTTGTT 107b-Actin TCCTCCCTGGAGAAGAGCTA...
  • 13
  • 563
  • 0
Báo cáo khoa học: Identification of tyrosine-phosphorylation sites in the nuclear membrane protein emerin pot

Báo cáo khoa học: Identification of tyrosine-phosphorylation sites in the nuclear membrane protein emerin pot

... pl2.33 Nagano A, Koga R, Ogawa M, Kurano Y, Kawada J,Okada R, Hayashi YK, Tsukahara T & Arahata K(1996) Emerin deficiency at the nuclear membrane in patients with Emery–Dreifuss muscular dystrophy. ... characterized by a mislocalization of emerin that is caused by the loss of emerin binding tolamin A (X- linked form) or by the loss of lamin A (autosomal dominant form) [22,23].Several emerin ... based on in vivolabeling of all the cellular proteins by isotope-codedamino acids. In addition, we used the determination of relative ratios of peptide abundance obtained fromproteins isolated...
  • 12
  • 429
  • 0
Báo cáo khoa học: Identification of substrates for transglutaminase in Physarum polycephalum, an acellular slime mold, upon cellular mechanical damage ppt

Báo cáo khoa học: Identification of substrates for transglutaminase in Physarum polycephalum, an acellular slime mold, upon cellular mechanical damage ppt

... actin, and PpANT are enzymaticallymodified by PpTGase in mechanically damaged macro-plasmodia.Cellular analysis of potential substrates in injured macroplasmodiaTo investigate the localization ... 2777Identification of substrates for transglutaminase in Physarum polycephalum, an acellular slime mold,upon cellular mechanical damageFumitaka Wada1,*, Hiroki Hasegawa1, Akio Nakamura2, Yoshiaki ... Okagaki T, Takagi T, Nakashima K,Yazawa M & Kohama K (2000) Calcium binding pro-perties of recombinant calcium binding protein 40, a major calcium binding protein of lower eukaryotePhysarum polycephalum....
  • 12
  • 195
  • 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... Ewing’s sarcoma (EWS) oncogene contains an N-terminal transcrip-tion activation domain and a C-terminal RNA-binding domain. Althoughthe EWS activation domain is a potent transactivation domain ... pGEX–EWS; EAD forward d(CGGAAT TCA TGG CGT CCA CGG ATT ACA G) and EADreverse d(CGC TCG AGT CAT CCG GAA AAT CCTCCA GAC T), for pGEX–EAD; RGG1 forward d(CGGAAT TCC CAG GAG AGA ACC GGA GCA T) andRGG1 ... proteinfamily contains the transcriptional activation domain in the N-terminal region and the RNA-binding domainKeywordsEwing’s sarcoma; G-quadruplex DNA;G-quadruplex RNA; RGG motif; RNA-bindingproteinCorrespondenceT....
  • 11
  • 786
  • 0
Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... Catlin BW (1990) Branhamella catarrhalis: an organismgaining respect as a pathogen. Clin Microbiol Rev 3,293–320.2 Karalus R & Campagnari A (2000) Moraxella catarrh-alis: a review of an ... AAG CCG ATG ACA CCA ATT (asd sense) This studyasd2 GCA GGT TCA TAG TGC ATG (asd antisense) This studyKan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19]Kan FP CTC ATC GAG CAT CAA ATG (kanamycin ... Barenkamp SJ, Robbins JB, Tsai CM,Lim DJ & Battey J (1998) Synthesis and characteriza-tion of lipooligosaccharide-based conjugates as vaccinecandidates for Moraxella (Branhamella) catarrhalis.Infect...
  • 14
  • 674
  • 0
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

... GTTCTTGTTCCTGCTCATCAGTATGTGGATCGCCAAAAACTCATGQM protein AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAAHYPK GGAAATGGAAATAACAAGACAAATAGCGCGCAACTAATGCTTCCACAAHSP70 TGACCAAGGCAACAGAACCAAATCAGACGGCCGGTATGTGHeat shock 70 kDa protein 1 2A ... CGAAAAAGGACAGCAGTTGAAACTCATCCTCCACCGGATTGTHSP23 CGTCCGATTTCTTCTCGTGTTTACCAGAAGACATTACAGTGAAAATTGAChaperonin-containing TCP1, subunit 7, isoform b, isoform 1 GGGAACCAGCAGTCGTCAAACGTCCACTGAGAGGATGAGACAInhibitor ... AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAARas family GTP-binding protein Rho1p GATACAGCAAACGGAAAGTCAACACAGTTCCTCGGGCCAACACystatin B GCCCCCCTCCCACACACATCTTCGGCCGTCTTTCCCTSL GTTCTTGTTCCTGCTCATCAGTATGTGGATCGCCAAAAACTCATGQM...
  • 11
  • 570
  • 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... 126,511–520.27 Tohse H, Murayama E, Ohira T, Takagi Y & Nagasa-wa H (2006) Localization and diurnal variations of car-bonic anhydrase mRNA expression in the inner ear of the rainbow trout Oncorhynchus ... structure–functionrelationship analysis of Prismalin–14 from the prismaticlayer of the Japanese pearl oyster, Pinctada fucata.FEBS J 274, 5158–5166.9 Murayama E, Takagi Y, Ohira T, Davis JG, GreeneMI & Nagasawa H ... M, Hasegawa K, HoritaC & Akera S (1999) A new matrix protein familyrelated to the nacreous layer formation of Pinctadafucata. FEBS Lett 462, 225–229.5 Kono M, Hayashi N & Samata T...
  • 12
  • 568
  • 0
Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

... cerevisiaestrain GIL77Two oligo DNAs (5¢-CTTCGTCGACAAGATGTGGAGGTTGAAGATA-3¢ and 5¢-GTCCGCTAGCTCAAGGCAAAGGAACTCTTCT-3¢), corresponding to the N- andC-terminal sequences of b-amyrin synthase from ... characterization of a cDNA encod-ing b-amyrin synthase involved in glycyrrhizin andsoyasaponin biosynthesis in licorice. Biol Pharm Bull 24,912–916.16 Hayashi H, Huang P, Inoue K, Hiraoka ... effects of soyasapogenol B derivatives. Bioorg Med Chem Lett7, 85–88.51 Banno N, Akihisa T, Tokuda H, Yasukawa K, Higashi-hara H, Ukiya M, Watanabe K, Kimura Y, HasegawaJ & Nishino H (2004)...
  • 12
  • 704
  • 0
Tài liệu Báo cáo khoa học: Identification of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

Tài liệu Báo cáo khoa học: Identification of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

... IFN-inducible transcriptional activation in the absence of the STAT2 DNA binding domain as determined by Affymetrix DNA microarrayanalysis. Total mRNA samples from U 6A- 2, U 6A- 2VV-II and U 6A cells ... STAT2 DNAbinding domain as revealed by DNA microarrayWe used DNA microarray analysis to compare thegene expression profiles of U 6A (STAT2-deficient),U 6A- 2 (intact STAT2), and U 6A- 2VV-II (mutantSTAT2 ... alpha, beta, or gamma using oligonucleotidearrays. Proc Natl Acad Sci USA 95, 15623–15628.21 Hannigan GE & Williams BR (1992) Interferon-alphaactivates binding of nuclear factors to a sequence...
  • 13
  • 459
  • 0
Tài liệu Báo cáo khoa học: Identification of membrane-bound serine proteinase matriptase as processing enzyme of insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1/angiomodulin/mac25) doc

Tài liệu Báo cáo khoa học: Identification of membrane-bound serine proteinase matriptase as processing enzyme of insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1/angiomodulin/mac25) doc

... 5¢-GGAUCAAAGAGAACACUGGGGUAUA-AG-3¢;and #1513 sense, 5¢-AGUUCACGUGCAAGAACAAGUUCUG-AG-3¢. The forward sequence of the scrambledRNA was 5¢-GAUCCAAGUAAUACAGAGAUGGGAGAG-3¢. OVISE cells were plated the day before ... of protease-activated receptor-2 and single-chainurokinase-type plasminogen activator as substrates.J Biol Chem 275, 26333–26342.34 Ihara S, Miyoshi E, Nakahara S, Sakiyama H, Ihara H,Akinaga A, ... The main fraction contained a 75 kDamatriptase as a major component and a few contamin-ating proteins as analyzed by SDS ⁄ PAGE.RNAi experiments with OVISE cellsMatriptase siRNAs and a scrambled...
  • 13
  • 603
  • 0

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam