Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx
... of a rat liver nuclear insoluble protein
fraction and localization of a novel protein, ISP36, to
compartments in the interchromatin space
Masashi Segawa
1
, Koko Niino
1
, Reiko Mineki
2
, Naoko ... the nuclear
lamina. Disruption of the integrity of the nuclear lam-
ina by mutation of lamin A ⁄ C causes Emery-Dreifuss
Keywords
ISP36...
... mass
spectrometry along with the availability of comprehensive
protein and DNA databases that made easy and quick
protein identification feasible. The analytical tools that are
available nowadays ... proteins in
Golgi preparations from rat mammary gland cells in the
state of maximal secretion at lactation as compared to that
in a state of basal secretion. This u...
... [32].
Together, the M and C domains of human eRF1, in
the absence of the N domain, are able to bind to the
mammalian ribosome and induce GTPase activity of
eRF3 in the presence of GTP [33].
The ... conformational rearrangements occurring
on a millisecond time scale and leading to an increase
in the transverse relaxation rate can be found in a
regi...
... terminus. Domain 1 contains the active-site at
the center of the b strands in the (b ⁄ a)
8
barrel, whereas domain 2
contains antiparallel b strands. The galactose ligand is shown in
yellow and ... 33,
7 1A.
4 Nakao S, Takenaka T, Maeda M, Kodama C, Tanaka
A, Tahara M, Yoshida A, Kuriyama M, Hayashibe H,
Sakuraba H et al. (1995) An atypical variant of Fabry’s
disease...
... CP-pyk
(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT
GACANNNNNNNNNNNNNNTGRTATAATNNNNAA
GTAATAAAATATTCGGAGGAATTTTGAAATGAATA
AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-
back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG
TC-3¢) ... (5¢-TGGTACTCGAG
CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG
AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and
downstream to pyk using primer pyk3 (5¢-GGAAGGA
TCCTTTGTCAATTAATGATCTTAAAAC-3¢)...
... plasminogen activator inhibitor-1 (PAI-1) is a
fast and specific inhibitor of the plasminogen activating
serine proteases tissue-type and urokinase-type plasminogen
activator and, as such, an important ... Mutational analysis of plasminogen activator inhibitor-1
Interactions of a- helix F and its neighbouring structural elements regulates
the activity and the rate of...
... staphy-
lococcal adhesins, comprising an N-terminal region that binds fibrinogen
and elastin, and a C-terminal domain that interacts with fibronectin. The
C-terminal domain of fibronectin-binding ... the
antibody epitope to the N-terminal segment and the fibronectin-binding site
to the C-terminal segment of the repeat. The distinct localization of the
15E11 epi...
... Semantic Analysis of Japanese Noun Phrases :
A New Approach to Dictionary-Based Understanding
Sadao Kurohashi and Yasuyuki
Sakai
Graduate School of Informatics, Kyoto University
Yoshida-honmachi, ...
N1 and a semantic role of a head word.
All definition sentences in RSK were analyzed
by JUMAN, a Japanese morphological analyzer,
and KNP, a Japanese syntactic...
... proteins
(Fig. 2A) . The high conservation of these domains
agrees with the important role of domain 1 on
DNA protein interaction and of domain 2 in the protein
dimerization and metal binding (see the Discussion).
There ... by MALDI-TOF peptide mass fingerprinting.
The proteins that show an increased level in the mutant correspond to a
DNA-binding hemoprotein,...