Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

... of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space Masashi Segawa 1 , Koko Niino 1 , Reiko Mineki 2 , Naoko ... the nuclear lamina. Disruption of the integrity of the nuclear lam- ina by mutation of lamin A ⁄ C causes Emery-Dreifuss Keywords ISP36...
Ngày tải lên : 30/03/2014, 20:20
  • 12
  • 400
  • 0
Báo cáo khoa học: Proteome analysis at the level of subcellular structures Mathias Dreger pot

Báo cáo khoa học: Proteome analysis at the level of subcellular structures Mathias Dreger pot

... mass spectrometry along with the availability of comprehensive protein and DNA databases that made easy and quick protein identification feasible. The analytical tools that are available nowadays ... proteins in Golgi preparations from rat mammary gland cells in the state of maximal secretion at lactation as compared to that in a state of basal secretion. This u...
Ngày tải lên : 23/03/2014, 20:22
  • 11
  • 493
  • 0
Báo cáo khoa học: Eukaryotic class 1 translation termination factor eRF1 ) the NMR structure and dynamics of the middle domain involved in triggering ribosome-dependent peptidyl-tRNA hydrolysis pptx

Báo cáo khoa học: Eukaryotic class 1 translation termination factor eRF1 ) the NMR structure and dynamics of the middle domain involved in triggering ribosome-dependent peptidyl-tRNA hydrolysis pptx

... [32]. Together, the M and C domains of human eRF1, in the absence of the N domain, are able to bind to the mammalian ribosome and induce GTPase activity of eRF3 in the presence of GTP [33]. The ... conformational rearrangements occurring on a millisecond time scale and leading to an increase in the transverse relaxation rate can be found in a regi...
Ngày tải lên : 07/03/2014, 05:20
  • 15
  • 538
  • 0
Báo cáo khoa học: Active-site-specific chaperone therapy for Fabry disease Yin and Yang of enzyme inhibitors pptx

Báo cáo khoa học: Active-site-specific chaperone therapy for Fabry disease Yin and Yang of enzyme inhibitors pptx

... terminus. Domain 1 contains the active-site at the center of the b strands in the (b ⁄ a) 8 barrel, whereas domain 2 contains antiparallel b strands. The galactose ligand is shown in yellow and ... 33, 7 1A. 4 Nakao S, Takenaka T, Maeda M, Kodama C, Tanaka A, Tahara M, Yoshida A, Kuriyama M, Hayashibe H, Sakuraba H et al. (1995) An atypical variant of Fabry’s disease...
Ngày tải lên : 30/03/2014, 03:20
  • 10
  • 548
  • 0
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

... regulator fascin 1 [27] and discordant changes of two calcium-dependent, actin-associated proteins (annexins A2 and A5 ), both regulating membrane dynamics, cell migration, proliferation and apoptosis [28]. ... kinase, 60S acidic ribosomal protein P2 (RPLP2), eukaryotic initiation factor 5A (eIF 5A) , parathymosin, L7 ⁄L12, annexin A2 , annexin A5 , aldolase A, fascin 1 and...
Ngày tải lên : 15/02/2014, 01:20
  • 11
  • 775
  • 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢)...
Ngày tải lên : 19/02/2014, 17:20
  • 12
  • 616
  • 0
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf

Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf

... plasminogen activator inhibitor-1 (PAI-1) is a fast and specific inhibitor of the plasminogen activating serine proteases tissue-type and urokinase-type plasminogen activator and, as such, an important ... Mutational analysis of plasminogen activator inhibitor-1 Interactions of a- helix F and its neighbouring structural elements regulates the activity and the rate of...
Ngày tải lên : 20/02/2014, 11:20
  • 9
  • 605
  • 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... staphy- lococcal adhesins, comprising an N-terminal region that binds fibrinogen and elastin, and a C-terminal domain that interacts with fibronectin. The C-terminal domain of fibronectin-binding ... the antibody epitope to the N-terminal segment and the fibronectin-binding site to the C-terminal segment of the repeat. The distinct localization of the 15E11 epi...
Ngày tải lên : 06/03/2014, 22:21
  • 16
  • 560
  • 0
Báo cáo khoa học: "Semantic Analysis of Japanese Noun Phrases: A New Approach to Dictionary-Based Understanding" doc

Báo cáo khoa học: "Semantic Analysis of Japanese Noun Phrases: A New Approach to Dictionary-Based Understanding" doc

... Semantic Analysis of Japanese Noun Phrases : A New Approach to Dictionary-Based Understanding Sadao Kurohashi and Yasuyuki Sakai Graduate School of Informatics, Kyoto University Yoshida-honmachi, ... N1 and a semantic role of a head word. All definition sentences in RSK were analyzed by JUMAN, a Japanese morphological analyzer, and KNP, a Japanese syntactic...
Ngày tải lên : 08/03/2014, 06:20
  • 8
  • 553
  • 0
Báo cáo khoa học: Functional analysis of two divalent metal-dependent regulatory genes dmdR1 and dmdR2 in Streptomyces coelicolor and proteome changes in deletion mutants ppt

Báo cáo khoa học: Functional analysis of two divalent metal-dependent regulatory genes dmdR1 and dmdR2 in Streptomyces coelicolor and proteome changes in deletion mutants ppt

... proteins (Fig. 2A) . The high conservation of these domains agrees with the important role of domain 1 on DNA protein interaction and of domain 2 in the protein dimerization and metal binding (see the Discussion). There ... by MALDI-TOF peptide mass fingerprinting. The proteins that show an increased level in the mutant correspond to a DNA-binding hemoprotein,...
Ngày tải lên : 16/03/2014, 18:20
  • 11
  • 315
  • 0

Xem thêm

Từ khóa: