The leg-to-body ratio as a human aesthetic criterion pdf
The leg-to-body ratio as a human aesthetic criterion pdf
... examined the utility of the human leg-to-body ratio (LBR) as a specific aesthetic criterion among 71 British undergraduates.Participants rated for physical attractiveness line drawings that varied ... ofsuch things as the mass media. In addition, someevolutionary psychological theories predict localvariation in aesthetic preferences as a result ofcalibration to locally prevailing ranges or ecologies(e.g., ... In addition, the length of the arms was altered accordingly. The legs were measured as the distance between the bottom of the feet and top of the pelvic region (above the hips and below the waist).The...
- 7
- 408
- 0
Tài liệu The Value of the Case Study as a Research Strategy doc
... important if other researchers are to be able to repeat a research programme: It is for this reason that researchers like Yin are especially adamant that a case database be created and maintained ... \allow repetition and re-evaluation of cases. Reliability is most important during the data collection phase, and involves the use of case study protocol as well as the case study database already ... that the application of the methodology is as likely (perhaps inherently) at fault as the methodology itself. (b) Qualitative research as preparation - As mentioned above, qualitative research...
- 15
- 587
- 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf
... protein with289 amino acids and a calculated molecular mass of32 kDa. A search of the nonredundant protein sequencedatabase was performed using the BLASTprogram. Besidessharing the same sequence ... (PerkinElmer).Northern blot analysisTotal Poly (A) +RNA from 13- and 33-week-old human fetal cerebrum (Biochain) was electrophoresed in a 1%agarose gel containing 0.66Mformaldehyde and wasblotted onto a ... model, then refined smoothly inalternating steps of automatic adjustment with CNS andmanual adjustment with the program O [34]. The finalmodel has a final R-factor of 0.222 with a free R-factor...
- 9
- 533
- 0
The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx
... to health care, increasingtechnology and associated costs, and the increasingperception of health as a business. All of these havecontributed towards increasing privatisation of healthcare ... Canada [75]. It concluded that increasing privati-sation of health care, especially home care, is nega-tively impacting women as care recipients, as healthcare workers, and as informal caregivers ... monopoly capitalism andcorporate globalization. Transnational corporations—many with home bases in the US—actively apply theirincreasing power to oppose reforms associated with the welfare state...
- 17
- 843
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... Maruyama S,Takahara M, Miyagishima SY, Mori T, Nishida K,Yagisawa F, Nishida K, Yoshida Y et al. (2004)Genome sequence of the ultrasmall unicellular red algaCyanidioschyzon merolae 10D. Nature ... paradoxa PsbU has a higher homology with the red algal protein than with the cyanobacterial one. The C. paradoxa thylakoid membranes also contained a band cross-reacted with anti-(R-PsbQ¢), the ... 8004–8012.4 Enami I, Murayama H, Ohta H, Kamo M, Nakazato K& Shen J-R (1995) Isolation and characterization of a photosystem II complex from the red alga Cyanidiumcaldarium: association of cytochrome...
- 11
- 501
- 0
Tài liệu Module 2: TCP/IP as a Solution for Networking pdf
... Depending on the routing protocols used, you can specify IP addresses based on: Classes (A, B, C) with an associated default mask. Classes with variable length subnet masks (VLSM). Classless ... class-based addresses and VLSM, you cannot decrease the number of bits that determine the network address below the number that is assigned to the default subnet mask. The following table ... routers, and NAT devices, require manual configuration of the address, mask, and neighbor or gateway addresses. Server applications that assign IP addresses and resolve symbolic names to IP addresses...
- 58
- 439
- 0
Tài liệu Controlling the Names Used in a Strongly Typed DataSet pdf
... either case, data is loaded into the DataSet and the collections of rows and columns in the DataSet are iterated over to display the data and to demonstrate the effect of the schema annotations. ... generate the strongly typed DataSet. The schema is annotated so that you can access the collection of rows in the table by using the Categorys property of the DataSet rather than categories, each ... Create the typed DataSet with name annotations. CategoriesDS_AnnotatedName ds = new CategoriesDS_AnnotatedName( ); // Fill the Categories table within DataSet. da.Fill(ds, CATEGORIES_TABLE);...
- 5
- 389
- 0
Tài liệu Put the Finishing touches On A Data Bound Form pdf
... _ ByVal e As System.ComponentModel.CancelEventArgs) Handles MyBase.Closing '- If an edit or add has been requested, enabling the Save button, ' then prompt to save the record ... • Add code to the Closing event of the form that tests whether you have made changes to the current record, and if so, whether you want to save the changes. You can see an example of particular ... bEnable These buttons are handled as the other buttons are-by taking the opposite value to which bEnable is currently set, and using it to toggle the Enabled property. Finally, if the bEnable...
- 6
- 304
- 0
Tài liệu Controlling Fine Particulate Matter Under the Clean Air Act: A Menu of Options pdf
... areas to Lowest Achievable Emission Rate (LAER) standards and in attainment areas to Best Available Control Technology (BACT). Neither BACT nor LAER standards are codifi ed because they are ... STAPPA and ALAPCO have prepared the document Alternative NOx Allowance Allocation Language for the Clean Air Interstate Rule, which contains alternative regulatory language for NOx allocation ... by Catalytica and Kawasaki, which operates at much lower gas temperatures, vastly reducing the amount of thermal NOx generated in the combustion process. The California Air Resources Board...
- 291
- 385
- 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf
... M. brassicae CSPMbraA6[32]. We observed also that BrC15-Ac was able to displaceASA, suggesting that brominated fatty acid and ASA bothassociated with W81 in the same ligand binding site. The ... nativesignal peptide was amplified by PCR using the followingprimers: 5¢ primer, 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak ... melanogasterejaculatory bulb [30], Mamestra brassicae proboscis [17],labial palps of the moth Cactoblastis cactorum [14] and cellsunderlying the cuticle in Phasmatodea and Orthoptera [31].Although...
- 11
- 642
- 0
Từ khóa: biological evolution of the saussurean sign as a component of the language acquisition devicethe civil war as a turning point in american history worksheetthe civil war as a turning point in american historyadvantages and disadvantages of using the english language as a medium of teachingthe civil war as a turning point in american history worksheet answersthe importance of establishing a human resource management system540 logic diagram for the pal16l8 used as a 74x138 decoder568 logic diagram for the pal16l8 used as a 74x153 like multiplexer569 logic diagram for the pal16l8 used as a specialized 4 input 3 bit multiplexeraccess a program element that has the same name as a keywordthe school counselor as a courtroom witnessthe american president as a bureaucratic leaderi have argued that the public administrator as a moral exemplar must act morally2012 the fsa may recover the outstanding amount as a debt owed by tbuk and due to the fsathe present value of the post tax cash flows from the activities of the companies involved in the exchange changes as a result of the transactionNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ