Báo cáo khoa học: Induction of PAI-1 expression by tumor necrosis factor a in endothelial cells is mediated by its responsive element located in the 4G/5G site ppt

... of KLF4 mRNA is most abundant in the colon and skin in mice, whereas expression of KLF4 is decreased in intestinal adeno-mas of multiple intestinal neoplasia mice and in colo-nic adenomas of ... cell adhesion to the endothelial surfaceand prolongation of clotting time following the induc-tion of KLF4 under in ammatory states, and implicat-ing KLF4 as a regulator of endothelial activation ... SR-BI expression in human mono-cytes and macrophages [16]. As a transcriptional factor, many target genes of KLF4 have been identified,including CYP 1A1 , human keratin 4, intestinal alkalinephosphatase,...

... interaction of its extracellulardomain [3]. Proteins such as p120-catenin, a- cateninand b-catenin assemble the cytoplasmic cell adhesioncomplex (CCC) on its intracellular domain and linkE-cadherin indirectly ... compilation ª 2006 FEBS 237domain), 5¢-CUACUUGGUUCGGUACAUGGG-3¢ and5¢-CAUGUACCGAACCAAGUAGGA-3¢; control siRNA5¢-GUACCUGACUAGUCGCAGAAG-3¢ and 5¢-UCUGCGACUAGUCAGGUACGG-3¢. The specificities of thesesequences ... blockage of E-cadherin by Decma elicits a signaling pathway downstream of E-cadherin that leads toSrc-dependent Shc and extracellular regulated kinase (Erk) activation andresults in uPA gene activation....

... significance of the element located in the 4G ⁄ 5G site of the PAI-1 promoter in the TNFa sti-mulation of PAI-1 expression in endothelial cells. PAI-1 expression wasmonitored at: (a) the level of ... NF-jB.ResultsUpregulation of PAI-1 expression in endothelial cells by ROS In preliminary experiments, we evaluated the role of ROS during the stimulation of PAI-1 expression in endothelial cells by TNFa. For this ... PAI-1 expression in vascular endothelial cells. Expression of PAI-1 was analyzed at the level of protein synthesis (A) in the presence or absence of NAC (10 mM). The PAI-1 antigen was determined...

... ¢;PPARb forward, 5¢—AAGAGGAGAAAGAGGAAGTGG—3¢; PPARb reverse, 5¢—ATTGAGGAAGAGGCTGCTGA—3¢; actin forward, 5¢—GATGATGATATCGCCGCGCTCGTCGTC—3¢; actin reverse, 5¢—GTGCCTCAGGGCAGCGGACCGCTCA—3¢.Quantitative ... PPARb induction in the presence of UO126 or actinomycin D. Shown is a quantitativeevaluation of a northern blot by PhosphorImaging.Fig. 4. Induction of PPARb transcriptional activity by AA is ... suggested the induction of an auto-crine ⁄ intracrine signaling loop upon activation of Raf.We therefore investigated whether 4-OHT treatment of N-BxB-ER cells would lead to an activation of the transcriptional...

... pro-vides a mechanism by which this protein can affect the actin cytoskeleton. PtdIns(4,5)P2 plays an importantrole in the attachment of the cytoskeleton to the plasma membrane as well as affecting actin ... presence of peptide. This is probably a result of the peptide partitioning more favorably into the liquid-crystalline phase than into the gel phase. In addition, the enthalpy of this transition in the ... significantamount of myristoylated N-terminal fragments of thisprotein are also present [2], indicating that the myristo-ylated N-terminal peptide of NAP-22, such as that used in this work, is also...

... IgE-dependenthistamine-releasing factor. Science 269, 688–690.14 Bheeka-Escura R, MacGlashan DW, Langdon JM &MacDonald SM (2000) Human recombinant histamine-releasing factor activates human eosinophils ... Total RNA was extracted at each time point, and TCTP mRNA was analyzed by northernblotting and quantified by scanning usingSCION IMAGE software. TCTP mRNA levels were normalized to internal ... attracted interest mainly as an antiapoptotic factor [5–7], for its role in tumorigenesis [8,9], and as a tubulin-binding [10] or Ca2+-binding protein [11,12].Moreover, it has other, extracellular,...

... ETSTTCCTGTGACTGACTTGTCCGCACTAACAGCCGCCCCACAACAATATGAGGAGTTACAAATGCTTTATTAATAATCATTNkx2. Nxk2.GAAGCATTGTTTGGAGTTTGAGCATCCTGGGAATAAAAATGATGAAAAAGGAAAAAGAGGATTGATTGGAAAGTTTATTTTAAGATCATCTTTGGGATGAATAGGAATCATCGATTCGGATCGAATTTGTGGCAGTAGCTGCAGTTTCATGTGTGTG ... Nxk2.GAAGCATTGTTTGGAGTTTGAGCATCCTGGGAATAAAAATGATGAAAAAGGAAAAAGAGGATTGATTGGAAAGTTTATTTTAAGATCATCTTTGGGATGAATAGGAATCATCGATTCGGATCGAATTTGTGGCAGTAGCTGCAGTTTCATGTGTGTG C/EBP C/EBPCTTTGTCGTAATTACGCCTCCGAAACTATGATATACTTCAGATTTTTAAATGAGGAGGCTTTTCATAATTATATAAAATGAGCGGGATACAGACTAAGATTATATTGTATGAGAACTAAGATTCTAAACCAAGTAGAAAAAACAAATCATTAAAATGATGGAGTTTTTTTCCTGCATTAATTT ... rev Mut GAAGATCTCGAACGAACGAGAAGACGGAGAAGAGGGA; C rev GAAGATCTCAAGTCAGTCACAGGAAAAGAGC; C rev MutGAAGATCTCAAGTCAGTCACAAGAAAAGAGC. In situhybridization The ÔBÕ domains of th e ets-1 and ets-2...

... :TCCTCGGACTCGAGTCGCCCCGTCCTTCTCCCTCGTCGAGGAGGCACCCCCTGGAAACTCTCGGGTCCTCGTCCTAAAGCTCCCTGTGGACCACCCCTCGTTTTCCACGACTCAGACAGAAACTGGAACTCGGGTCGAACAAAGAGGACGTAGGAGGGGGTTTTCCCCGAAACGGACAGTAAGACGTCAAGATCACACCCCAGACCCGCGTCAAGAAAAGGGAGAGGTCGGAGCCTCAGAAGGAGACACCTGACGCGTCTATCCTGACCACCGTGCCTGGTCGAGACGTCGGGACCTCAGTCCTCGTCTCGGGGGGCCGAGGGTCGGGCGGCATCGGCGAGGACCGTGGCTCGCTCGGCGCTACTGTTACCGACGTAACACGAAGTACAGGGAAGGGTAGTTGTAAAGACACGACCTGAGGAAGGTGAGCGCCCAGCAGAGGTCTCGAGTCTTTTACTCCACTAGTCACCCTGCTCATTCCTTCCCCCCAACCCTCTCCCCGCTAACCCGTTGGGCCGACGTGTTTGTGCCCTCCAGTTTCTAACGCGGGTCGGGCGGGTCCGGCCCTTACCTTATTTCCCTGCGCCCCGCGGCCTCCGAp300SP-1AP-1 ... ACCTACGCCCCACTAACACACACACACACCACCACCACAAACGGGACCACCACCTAAGGTACGCGTCAAGACAGGGTGTATAGTCCTTTACTCCACTGGTAGTC-CCGTTCTTTCCTTCCCCC ACCCACGTCCCGCTAAAAAACA ACCTAAGGTGGGTGCCCAGACAAGGTCTCCAGTCCTTTACTCCACTAGTCGGGGCCGCTCCTTACTTCCCCCT-CCCGACTCCCCTCTAAAACGCG ... :TCCTCGGACTCGAGTCGCCCCGTCCTTCTCCCTCGTCGAGGAGGCACCCCCTGGAAACTCTCGGGTCCTCGTCCTAAAGCTCCCTGTGGACCACCCCTCGTTTTCCACGACTCAGACAGAAACTGGAACTCGGGTCGAACAAAGAGGACGTAGGAGGGGGTTTTCCCCGAAACGGACAGTAAGACGTCAAGATCACACCCCAGACCCGCGTCAAGAAAAGGGAGAGGTCGGAGCCTCAGAAGGAGACACCTGACGCGTCTATCCTGACCACCGTGCCTGGTCGAGACGTCGGGACCTCAGTCCTCGTCTCGGGGGGCCGAGGGTCGGGCGGCATCGGCGAGGACCGTGGCTCGCTCGGCGCTACTGTTACCGACGTAACACGAAGTACAGGGAAGGGTAGTTGTAAAGACACGACCTGAGGAAGGTGAGCGCCCAGCAGAGGTCTCGAGTCTTTTACTCCACTAGTCACCCTGCTCATTCCTTCCCCCCAACCCTCTCCCCGCTAACCCGTTGGGCCGACGTGTTTGTGCCCTCCAGTTTCTAACGCGGGTCGGGCGGGTCCGGCCCTTACCTTATTTCCCTGCGCCCCGCGGCCTCCGAp300SP-1AP-1...

... ultrasonographywould have been a better clinical marker and mayhave provided more reliable information. In summary, increased visceral adiposity is associ-ated with increased proinflammatory factors ... organ,which increases the production of in ammatory cytokines (e.g.IL-6, TNFa) as well as lipoprotein lipase, angiotensinogen, free fattyacids, resistin, leptin, lactate, PAI-1, insulin and adipsin, ... increasedlevels of proinflammatory factors and decreased anti- in ammatory cytokines [125,126]. Interestingly, testo-sterone therapy prevents a gain in visceral adiposetissue in non-obese aging...

... partner, the RXR, and aresubject to cross-talk interactions with other nuclear recep-tors and with a broad range of other intracellular signalingpathways, including those activated by certain ... transformation of preginto androstadienol, a precursor in the biosynthesis of Fig. 5. In uence of increasing concentrations of cyt b5on the relativeformation of androstadienol and DHEA by human P450c17. ... precisely, an increase of androsta-dienol formation was observed at a cyt b5/P450c17 ratio of 5 : 1 (Fig. 5). The activity reached a maximum at a ratio of 12 : 1. Thus, the in uence of human...