0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

... the action of the ataxia telangiectasia mutated (ATM) ⁄ataxia telangiectasia and RAD53 related (ATR)kinases at the site of DNA damage may decrease the kinase ⁄ phosphatase ratio and allow the ... 2008 The Authors Journal compilation ª 2008 FEBS 4221 Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage Cristina ... playing a role in the cisplatin response [9]. Cisplatin interferes with DNA function by causing intrastrand and interstrand cross-linking of nucleotide bases and, in replicating cells, DNA damage...
  • 11
  • 362
  • 0
Báo cáo khoa học: Studies on the role of the receptor protein motifs possibly involved in electrostatic interactions on the dopamine D1 and D2 receptor oligomerization pdf

Báo cáo khoa học: Studies on the role of the receptor protein motifs possibly involved in electrostatic interactions on the dopamine D1 and D2 receptor oligomerization pdf

... lg of DNA per 100 mm dish and2 lg of DNA per 30 mm dish. The ratio of DNA codingdonor to DNA coding acceptor was 1 : 1 or 1 : 2.Membrane preparation and radioligandbinding assayFor binding ... (two each) from the arginine-rich epitope (217RRRRKR222) of the third intra-cellular loop were exchanged (D2R1: 217AARRKR222,D2R2: 217AAAAKR222, D2R3: 217AAAAAA222), as wellas one variant ... could have been interpreted as a directindication of the role of the Arg-rich epitope in the for-mation of heterodimers, as had been done in case of adenosine A 2A –dopamine D2heterodimerization...
  • 16
  • 567
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Re-evaluating the Role of B LEU in Machine Translation Research" ppt

... 2005). The remaining six entrieswere all fully automatic machine translation sys-tems; in fact, they were all phrase-based statisticalmachine translation system that had been trainedon the same ... already stated that Kharazi’s state-ments to the conference because of the Jor-danian King Abdullah II in which he stoodaccused Iran of interfering in Iraqi affairs.n-gram matches: 27 unigrams, ... Florida3-grams: American plane that, American plane which,Miami , Florida, Miami in Florida, Orejuela appearedcalm, Orejuela seemed quite, appeared calm as, appearedcalm while, as he was, being escorted...
  • 8
  • 455
  • 0
Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx

Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx

... 764pA::GUS) 234AFAAAAAGCAGGCTGAGAAATCTATGGAATAAATAAAAATTAGGGb) 234pA::GUSPromARAGAAAGCTGGGTCGATGTTTCACTGAAACATTAATAGATATTCb,cAll chimeric cardosin A constructs exceptpADi::GUSPromARDiAGAAAGCTGGGTCGATGTTTCATCACGTGTTATTTGATGGAAGCAATGb,c,dpADi::GUS) ... 2912pA::GUS andpADi::GUS) 1792AFAAAAAGCAGGCTTGCTGTTCTAAGTGTACTAGCTGGAb) 1792pA::GUS) 1263AFAAAAAGCAGGCTCAAATTAAATCGACGGTTGAGb) 1263pA::GUS) 764AFAAAAAGCAGGCTCAATGTAGTACCAATTGGGGTACCb) 764pA::GUS) ... TTTATTGGACCATTTTATTCCGG Probe CB-3¢ActF GATATGGAAAAGATCTGGCATCAC RT-PCR(Atactin 2)ActR TCATACTCGGCCTTGGAGATCC RT-PCR(Atactin 2)) 2912AFAAAAAGCAGGCTATGAATTGCTAGAGTTGGTTAATGCb) 2912pA::GUS...
  • 17
  • 359
  • 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... respiratory chain, the assistance of specificchaperone proteins is also required. The available dataindicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc1intermediate[28,29] ... present in comparable amounts in both yeast strains. Therefore, the reason for the disap-pearance of the bc1dimer in the yeast strain in whichQcr10p is missing remains unknown.On the basis of all ... bc1 complex in these two deletion strains, thus leading to the hypothesisthat the addition of ISP may play a pivotal role in the structural rearrangement of the yeast bc1 complex thatfinally...
  • 15
  • 639
  • 0
Tài liệu Báo cáo khoa học: Looking for the ancestry of the heavy-chain subunits of heteromeric amino acid transporters rBAT and 4F2hc within the GH13 a-amylase family ppt

Tài liệu Báo cáo khoa học: Looking for the ancestry of the heavy-chain subunits of heteromeric amino acid transporters rBAT and 4F2hc within the GH13 a-amylase family ppt

... men-tioning that, especially in higher animals (mammalsand also in frogs and fishes), an aspartate (asparticacid 248 in human 4F2hc; aspartic acid 380 in Fig. 1as both the N-terminal and transmembrane ... domain,including domain B and the C-terminal domain C forrBAT proteins (669 residues on average); (b) the cata-lytic TIM barrel domain, including domain B and the C-terminal domain C for GH13 ... segment of TIMbarrel domain); and (c) protein evolution in general.On the basis of our analysis, it seems that the hcHATsare present in animals starting from basal Metazoa, aswe were unable...
  • 14
  • 564
  • 0
Tài liệu Báo cáo khoa học: Insights into the structure of plant a-type phospholipase D Susanne Stumpe, Stephan Konig and Renate Ulbrich-Hofmann ¨ ppt

Tài liệu Báo cáo khoa học: Insights into the structure of plant a-type phospholipase D Susanne Stumpe, Stephan Konig and Renate Ulbrich-Hofmann ¨ ppt

... with the latter being dominant. The fluorescence and near-UV CD spectra point to tight packing of the aromatic residues in the core of the protein. From the near-UV CD signalsand activity data as ... members of the PLD superfamily. However, there is low similar-ity in the remaining parts of the molecules. Most mam-malian PLDs contain a PX and a PH domain instead of the C2 domain in plants, ... illustrates the quality of the experimental data(Fig. 2B).Reconstruction of the overall shape of the PLDa2 from the X-ray scattering data was achieved by the ab initio modeling program dammin [24]....
  • 11
  • 750
  • 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

... Kaneko1, Yuanying Ding1, Kazuhiro Ogawa2,*,Miki Yoshizawa1, Masaki Kawamura1, Kazuhisa Takeda1, Tadashi Yoshida3and Shigeki Shibahara11 Department of Molecular Biology and Applied ... 1162–1168.13 Nakayama M, Takahashi K, Kitamuro T, YasumotoK, Katayose D, Shirato K, Fujii-Kuriyama Y & Shiba-hara S (2000) Repression of heme oxygenase-1 byhypoxia in vascular endothelial cells. ... contained RNA prepared from untreated cells harvested just before starting the experiment.At the bottom of each panel, 28S rRNA of each sample was visualized by ethidium bromide staining. The data...
  • 12
  • 621
  • 0
Tài liệu Báo cáo khoa học: Fatty acid synthesis Role of active site histidines and lysine in Cys-His-His-type b-ketoacyl-acyl carrier protein synthases ppt

Tài liệu Báo cáo khoa học: Fatty acid synthesis Role of active site histidines and lysine in Cys-His-His-type b-ketoacyl-acyl carrier protein synthases ppt

... Threeassays were carried out on the purified enzymes. (a) The acyltransferase assay measures the ability of a KAS protein toaccept a fatty acid substrate from the ACP. To 48 lL con-taining 50 ... start of the 10 min reaction. (B) The bulky and acidic mutant proteins compared with the inactive K32 8A protein. Lane 1 represents the amount of labeled substrate at the start of the 30 min reaction. ... extracts of this strain are unableto extend radiolabeled acetate (lane 5) in 30 min assaysat 42 °C. Addition of wild-type KAS I resulted in syn-thesis of long-chain saturated and unsaturated...
  • 16
  • 450
  • 0
Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate specificity by replacement of Asn149 with Asp docx

Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate specificity by replacement of Asn149 with Asp docx

... agmatinase activity of the Asn149Asp vari-ant, it is clear that the interactions of arginase II withl-arginine and agmatine are greatly altered by replace-ment of this residue with aspartate. ... complex [9].Certainly, if an interaction between Asn149 and the a- carboxylate group of arginine were also operativefor arginase II, both the lack of arginase activity aswell as the resistance ... [22]. A key factor is the a- carboxyl group of the substrate, which makes the difference betweenarginine and agmatine. Agmatine, which results from decarboxylation of arginine by arginine decarboxylase,is...
  • 9
  • 651
  • 0

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ