0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Collective behavior in gene regulation: The cell is an oscillator, the cell cycle a developmental process doc

Báo cáo khoa học: Collective behavior in gene regulation: Metabolic clocks and cross-talking doc

Báo cáo khoa học: Collective behavior in gene regulation: Metabolic clocks and cross-talking doc

... like tissues and organs?This question is of particular importance when single- cell micro-organisms are considered but the results arenot concordant. In cyanobacteria, the circadian clock is a ... material? Onehypothesis about the evolution of the circadian clockand YMC is that they allowed the segregation ofpotential harmful reactions, UV mutagenesis andROS damage, and protect organisms. ... [11]. The circadian clock is intimately connected withmetabolism, in particular with the redox balance in the cell [the NAD(P)H ⁄ NAD(P) ratio] and heme metabo-lism [12,13] and with cyclic transcriptome...
  • 8
  • 270
  • 0
Báo cáo khoa học: Collective behavior in gene regulation: The cell is an oscillator, the cell cycle a developmental process doc

Báo cáo khoa học: Collective behavior in gene regulation: The cell is an oscillator, the cell cycle a developmental process doc

... replicating and dividing with the minimal genera-tion times. Kinetically, the yeast stochastic tissue and a mammalian tissue such as the epithelial cells of the gastro-intestinal tract are similar ... points for analysis of microarray data is the idea that the underlying process involves cells thatexist at a steady state and that the values obtainedcome from an ergodic process. The distinction ... normalizing standards is a time-honored practice in PCR and other amplificationassays. Warrington et al. [36] addressed this question in an analysis of human adult and fetal tissues. Of the 535 genes...
  • 13
  • 238
  • 0
Báo cáo khoa học: Insulin resistance in human adipocytes occurs downstream of IRS1 after surgical cell isolation but at the 1 level of phosphorylation of IRS1 in type 2 diabetes pot

Báo cáo khoa học: Insulin resistance in human adipocytes occurs downstream of IRS1 after surgical cell isolation but at the 1 level of phosphorylation of IRS1 in type 2 diabetes pot

... resistance in both man and animals [8]. Attempts to examine this atcellular and molecular levels have yielded conflictingresults. In isolated human fat cells obtained after, ascompared to before, abdominal ... small incision in the abdominal skinunder local anaesthesia. Also, in these cases ERK1 ⁄ 2were phosphorylated and insulin had no further effectwhen analyzed directly (Fig. 6A) , but when analyzedafter ... sub-jects. (A) Abdominal subcutaneous adipose tissue was obtained by a small incision under local anaesthesia and cells isolated. The cellswere incubated with or without 100 nM insulin for 10 min,...
  • 11
  • 472
  • 0
Báo cáo khoa học: Oligosaccharide synthesis in Fibrobacter succinogenes S85 and its modulation by the substrate potx

Báo cáo khoa học: Oligosaccharide synthesis in Fibrobacter succinogenes S85 and its modulation by the substrate potx

... Clermont-Ferrand-Theix, 63122 Saint -Gene `s-Champanelle, France3 Institute of Chemistry, Slovak Academy of Sciences, Dubravska cesta 9, 842 38 Bratislava, Slovak RepublikCellulolytic bacteria play an ... Intracellular and extracellular media were analysed by1H-NMRand by TLC. The first important finding is that no cellodextrins werefound to accumulate in the extracellular media of cells, regardless of the substrate; ... substrate, and can beused by the bacteria. Maltotriose plays a key role in this metabolism ofmaltodextrin. Maltodextrin-1-phosphate was detected in all the incuba-tions, and a new metabolite,...
  • 12
  • 406
  • 0
Báo cáo khoa học: Pyruvate metabolism in rat liver mitochondria What is optimized at steady state? pptx

Báo cáo khoa học: Pyruvate metabolism in rat liver mitochondria What is optimized at steady state? pptx

... carboxylase by acetyl-CoA and ADP is ignored.Second, different exchangers such as the citrate–malateantiporter and the malate–oxoglutarate exchanger werealso omitted. The main reason for this was not ... plus the measured extramitochondrial products. A major advantage of this method is that neither kinetic simulations norradioactive tracers are needed.AbbreviationsACAC, acetoacetate; AcCoA, acetyl-CoA; ... reactions, because it is closest to the experiment. This is also in accordance with the data shown in Table 2 in which malate and citrate are the main products. This does not mean, however, thatno...
  • 10
  • 324
  • 0
Báo cáo khoa học: Novel modified version of nonphosphorylated sugar metabolism – an alternative L-rhamnose pathway of Sphingomonas sp. doc

Báo cáo khoa học: Novel modified version of nonphosphorylated sugar metabolism – an alternative L-rhamnose pathway of Sphingomonas sp. doc

... was carriedout against bacterial and archeal genome sequences using the metabolic genes involved in an alternative l-rhamnosepathway of P. stipitis, D. hansenii and A. vinelandii LRA1–4. Candidate ... Watanabe S, Shimada N, Tajima K, Kodaki T & Maki-no K (2006) Identification and characterization ofL-arabonate dehydratase, L-2-keto-3-deoxyarabonatedehydratase and L-arabinolactonase involved ... obtained about sugarpathways analogous to the ED pathway, including the alternative l-rhamnose pathways of fungi and bacteria(Fig. 1). Therefore, an extended bioinformatic analysiswas carried...
  • 14
  • 329
  • 0
Tài liệu Báo cáo khoa học: Complex transcriptional and translational regulation of iPLA2c resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization docx

Tài liệu Báo cáo khoa học: Complex transcriptional and translational regulation of iPLA2c resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization docx

... TGCTCCATGGTGGCATCCCAATATGTAAACCA83 83F GAACCAAGCTTGAAGCACATTCTTGCAGTAAGCA83R CAAAACATGTTGGCTACGGGACATACAAATGTTCA80 80F GTTGAAGCTTTTTGAAACTTAGCACTTCTGC80R ATTCCATGGTGGCTGAAATCATTTCATTTTGATTGCC74 ... (5¢-TATTAATCTGACTGTAGATATATATATATTACCTCCTTAGTAATGC-3¢) and random-ized control g50c (5¢-TTGATAGTTATCTATTACAGTCTTCTTAGATTGAAACAA-3¢), g177 (5¢-CATACAAACATAATAAGATGTAAATGG-3¢) and control g177c(5¢-TCATCTAAGTACAATAGATAGAAGAAA-3¢),g230 ... complement-ary 5¢-phosphorylated primers (5¢-TCGAGCCAC CATGATTTCACGTTTAGCTCAATTTAAGCCAAGTTCCCAAATTTTAAGAAAAGTAG-3¢ and 5¢-TCGACTACTTTTCTTAAAATTTGGGAACTTGGCTTAAATAAACGTGAAATCATGGTGGC-3¢) were annealed...
  • 16
  • 438
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Age Prediction in Blogs: A Study of Style, Content, and Online Behavior in Pre- and Post-Social Media Generations" ppt

... Social media and youngadults.Ian Mackinnon. 2006. Age and geographic inferencesof the livejournal social network. In In StatisticalNetwork Analysis Workshop.Andrew Y Ng and Michael I Jordan. 2002. ... Fastexact inference with a factored model for naturallanguage parsing. In Advances in Neural Informa-tion Processing Systems, volume 15. MIT Press.Ravi Kumar, Jasmine Novak, Prabhakar Raghavan,and ... (Pennebaker andStone, 2003; Robins et al., 2002). Goswami etal. (2009) add to Schler et al.’s approach using the same data and have a 4% increase in accu-racy. However, the paper is lacking details...
  • 10
  • 540
  • 1
Báo cáo khoa học: K182G substitution in DevR or C8G mutation in the Dev box impairs protein–DNA interaction and abrogates DevR-mediated gene induction in Mycobacterium tuberculosis doc

Báo cáo khoa học: K182G substitution in DevR or C8G mutation in the Dev box impairs protein–DNA interaction and abrogates DevR-mediated gene induction in Mycobacterium tuberculosis doc

... CGACACGTAGTTCGCCACCGTCTTTTCfdxA-C8G f TGACGAATAAGGCGTTTGGTCCTTTCCfdxA-C8G r GGAAAGGACCAAACGCCTTATTCGTCAfdxA -A9 T f TGACGAATAAGGCCATTGGTCCTTTCCfdxA -A9 T r GGAAAGGACCAATGGCCTTATTCGTCAfdxA-C8G -A9 T f TGACGAATAAGGCGATTGGTCCTTTCCfdxA-C8G -A9 T ... TGACGGGCTATCGTAAGTTTATGfdxA r CACGCACTCACTACCGATCACAK182G f GAAAAGACGGTGGGGAACTACGTGTCGK182G r CGACACGTAGTTCCCCACCGTCTTTTCK18 2A f GAAAAGACGGTGGCGAACTACGTGTCGK18 2A r CGACACGTAGTTCGCCACCGTCTTTTCfdxA-C8G ... contain a combination of strong and weakbinding sites [12,13]. Taking into consideration the results of DNase I footprinting analysis and in vivoassays, it appears that DNA bending ⁄ distortion...
  • 9
  • 351
  • 0
Báo cáo khoa học: Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor 1 pot

Báo cáo khoa học: Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor 1 pot

... FEBSAlthough bone marrow transplantation improvesmany aspects of the somatic manifestations, it has a limited impact on cardiac, eye and skeletal abnormali-ties, in addition to the risk of fatal ... we showed that SUMF1 coexpression allowed a substantial increase in GALNS activity in trans-duced cells and their media, indicating the advantageof coexpression of SUMF1 and GALNS. The effect ... C, Warrington K, Siemann D & MuzyczkaN (2002) Comparison of the EF-1 alpha and the CMVpromoter for engineering stable tumor cell lines usingrecombinant adeno-associated virus. Anticancer...
  • 12
  • 460
  • 0

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)