Báo cáo khoa học: Lending a helping hand, screening chemical libraries for compounds that enhance b-hexosaminidase A activity in GM2 gangliosidosis cells pptx
Báo cáo khoa học: Lending a helping hand, screening chemical libraries for compounds that enhance b-hexosaminidase A activity in GM2 gangliosidosis cells pptx
... Journal 274 (2007) 4951–4961 ª 2007 The Authors Journal compilation ª 2007 FEBS 4961MINIREVIEW Lending a helping hand, screening chemical libraries for compounds that enhance b-hexosaminidase A activity ... Pyrimethamine, an antimalarial drug with well documentedpharmacokinetics, was confirmed as a b-hexosaminidase pharmacologicalchaperone and compared favorably with our best carbohydrate-based phar-macological ... &Mahuran D (2007) High-throughput screening for human lysosomal beta-N-acetyl hexosaminidase Screening libraries for hexosaminidase enhancers M. B. Tropak and D. Mahuran4960 FEBS Journal...
- 11
- 348
- 0
Tài liệu Báo cáo khoa học: Mouse recombinant protein C variants with enhanced membrane affinity and hyper-anticoagulant activity in mouse plasma pptx
... binding characteristics and hyper-anticoagulant activity. Binding ability was establishedusing a SPR membrane binding assay and anticoagu-lant activity was assessed by a thrombin generationassay. ... plasma remains unknown but maybe a result of rat FVa ⁄ FVIIIa being poor substrates for human APC [21].APC variants with enhanced anticoagulant activity resulting from improved membrane-binding ... numbered lanes) wasapplied to each lane and visualized by silver staining. Protein C vari-ants and molecular weight markers (MWM) ran in each lane areindicated. The location of heavy chain (HC),...
- 17
- 495
- 0
Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf
... CTAGAAAAAGTTGCTGTACTCATCCATGTGTCATGGATGAGTACAGCAAPrPCRNAi2 Sense TTTGGTGATACACATCTGCTCAACATGAGCAGATGTGTATCACCTTTTTAntisense CTAGAAAAAGGTGATACACATCTGCTCATGTTGAGCAGATGTGTATCACAkt RNAi Sense TTTGTAGTCATTGTCCTCCAGCACAGCTGGAGGACAATGACTACTTTTTAntisense ... CCCAAGCTTGGGATGGCGAACCTTGGCTGCTAntisense CGGGATCCTCCCACATCAGGAAGATGAGGAPrPCRNAi1 Sense TTTGTTGCTGTACTCATCCATGACACATGGATGAGTACAGCAACTTTTTAntisense CTAGAAAAAGTTGCTGTACTCATCCATGTGTCATGGATGAGTACAGCAAPrPCRNAi2 ... TTTGTAGTCATTGTCCTCCAGCACAGCTGGAGGACAATGACTACTTTTTAntisense CTAGAAAAAGTAGTCATTGTCCTCCAGCTGTGCTGGAGGACAATGACTAMDR-1 Sense CTCGAGGAATCAGCATTCAGAntisense AGATCTCTTTGAGCTTGGAAGAGCMDR-1 promoter Sense CTCGAGGAATCAGCATTCAGAntisense AGATCTCTTTGAGCTTGGAAGAGCJ....
- 10
- 448
- 0
Báo cáo khoa học: Acetyl-CoA:1-O-alkyl-sn-glycero-3-phosphocholine acetyltransferase (lyso-PAF AT) activity in cortical and medullary human renal tissue docx
... microsomal lyso-PAF AT activity of human cortex and medullaAs shown in Fig. 3, a plateau of maximum activity, for bothcortical and medullary lyso-PAF ATs, was observed for BSA concentrations ranging ... routinely used for thedetermination of lyso-PAF AT activity [30].Both cortical and medullary lyso-PAF AT activities sharesimilar biochemical characteristics indicating that they areoriginated ... showing that the majorPAF species synthesized by rat glomerular mesangial cells isthe ether analog of PAF [33]. The inability of lyso-PAF ATto act on ALPA indicates that the lyso-PAF AT activity...
- 9
- 324
- 0
Báo cáo khoa học: Curcumin suppresses the dynamic instability of microtubules, activates the mitotic checkpoint and induces apoptosis in MCF-7 cells ppt
... curcuminincreased the accumulation of Mad2 and BubR1 at the kinetochores, indi-cating that it activated the mitotic checkpoint. In addition, curcumin treat-ment increased the metaphase ⁄ anaphase ... curcumin caused a delay in mitosis, it might lead to an increase in themetaphase ⁄ anaphase ratio. The metaphase ⁄ anaphaseratio was calculated to be 0.43 ± 0.06 and1.88 ± 0.40 (P < 0.0001) in ... 73–75.5 Aggarwal BB, Kumar A & Bharti AC (2003) Antican-cer potential of curcumin: preclinical and clinical stud-ies. Anticancer Res 23, 363–398.6 Dohare P, Garg P, Jain V, Nath C & Ray M...
- 12
- 372
- 0
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf
... protein kinase 1 (DAPK-1) is a Ca2+⁄ calmodulin-regulated serine ⁄ threonine kinasecomposed of multiple functional domains, including a kinase domain, a calmodulin-binding domain, eightankyrin ... glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA quantification in coloncarcinoma and rectal carcinoma as compared to normal colonic tissue. Colon carcinoma cells, rectal carcinoma cells and ... tumorsuppressor pathway [7].DAPK-1 is relatively large for a protein kinase, andits independent functional domains are involved in var-ious regulatory activities. The DAPK-1 kinase domainis required...
- 11
- 659
- 0
Tài liệu Báo cáo khoa học: Post-translational cleavage of recombinantly expressed nitrilase from Rhodococcus rhodochrous J1 yields a stable, active helical form ppt
... enzymes that convertnitriles to the corresponding carboxylic acids andammonia. They belong to a superfamily [1] that includes amidases, acyl transferases and N-carbamoyl-d-amino acid amidohydrolases, ... forming and maintaining the helix, and suggest that oligomerization utilizing these or similar interactionsmay be common among microbial nitrilases, cyanidedihydratases and cyanide hydratases. ... buffer B. At the end of each chromatographicstep, the active protein was investigated by negative-stainelectron microscopy.Assay for enzyme activity Nitrilase activity was analysed by assaying the...
- 10
- 450
- 0
Tài liệu Báo cáo khóa học: The effect of mutations surrounding and within the active site on the catalytic activity of ricin A chain pptx
... active site of RTA in an openconformation is not included in this study as, althoughseveral favourable interactions between the hexanucelotideand RTA are maintained, many additional interactions ... Table 1.Assay of theN-glycosidase activity of ricin A chainvariantsThe activity of each of the RTA variants was determinedby assessing their ability to depurinate 26S rRNA ofTable 1. Data ... by relating the amounts ofthe small aniline-fragment and 5.8S rRNA and expressingvalues as a percentage.Reassociation and quantification of ricin A- chain variantsPurified RTA (100 lg) was mixed...
- 10
- 616
- 0
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx
... solutionat pH 7.0: indigo tetrasulfonate, indigo trisulfonate, indigodisulfonate, anthraquinone-2-7-disulfonate, anthraquinone-2-sulfonate, safranine O, diquat, neutral red, phenosafranine,and ... of pairwise interactions in a multicentre proteinhas been explored when forming a complex, and theseinteractions also show small modifications relative tothe isolated protein, indicating that ... dramatic differ-ence in size, and in agreement with previouscomparative work of binding inorganic and proteinpartners to cytochromes c3[6]. Table 2 shows that as for the case of phosphate...
- 10
- 640
- 0
Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt
... frag-ments containing a complete x-5 gliadin gene, oligonucleo-tides, 5 ¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢and 5¢-CGTTACATTATGCTCCATTGACTAACAACGATG-3¢, were constructed based on fragment DNA ... Foster City, CA, USA).Expression and purification of recombinantproteinSense (5¢-ATTTCATATGCAACAACAATTCCCCCAGCAACAATCA-3¢) and antisense (5¢-TCTCGGATCCTCATAGGCCACTGATACTTATAACGTCGCTCCC-3¢) ... addition, the causative allergen is dif-ferent in various clinical manifestations, for instancethe major allergen for baker’s asthma is a- amylaseinhibitor whereas that for WDEIA is x-5 gliadin [19].Recent...
- 8
- 484
- 0
Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpchuyên đề điện xoay chiều theo dạngđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP