Báo cáo khoa học: Deviation of the neurosporaxanthin pathway towards b-carotene biosynthesis in Fusarium fujikuroi by a point mutation in the phytoene desaturase gene ppt

... fujikuroi by a point mutation in the phytoene desaturase gene Alfonso Prado-Cabrero1, Patrick Schaub2, Violeta Dıáz-Sańchez1, Alejandro F. Estrada1,Salim Al-Babili2and Javier Avalos11 ... manufacturer’s instructions.Two microlitres of cDNA were used for the amplification of carB using the primers 5¢-ATGAGCGACATTAAGAAATCTG-3¢ and 5¢-CTAATTCGCAGCAATGACAAG-3¢. The PCR was performed using 500 ... upstream of the start codon and the first 957 bp of the carB coding sequence, and 5¢-CGTTGAGGCACTGGTTAACG-3¢ and 5¢-CGAGAATCATGGACATAGAC-3¢, covering the last coding 1048and 88 bp downstream of the...

Báo cáo khoa học: Transcription of mammalian cytochrome c oxidase subunit IV-2 is controlled by a novel conserved oxygen responsive element pptx

... reverseCTCGCGGGCTCGGCAGTGGGAGPprom+1AGTCTATTCTCGAGCACCTGGGACTACAGGPprom+2AGTCTATTCTCGAGCCCAAAGCGCTGAGATTACAGPprom+3AGTCTATTCTCGAGATGCTTCTGGAGTAGGAGGCAPprom+4AGTCTATTCTCGAGGTGTGGAGGAGGCAGGGAGACPprom+5AGTCTATTCTCGAGGAGGCGCTCTGCAGTGCCTCPprom+6AGTCTATTCTCGAGAAGCAGGACGTTCCCACGCTGPprom+7AGTCTATTCTCGAGGGGGCGGGCGCCCGCACTCAGPpromreverseAGTCTATTCTCGAGCGCGACCTGGGTCTGCCCAGPORE ... EMSA.Primer ID Sequence (5’- to 3’)P-1cowTCTTGCGGCTTGGAGAGAGCCAGP-2cowCCAGAACGCGACCCAGGTCP-3cowCAGGTCTGCAGAGCAAGCAACAGP-1ratTAGTTGCAAGCTGAAGACCGP-2ratGCTGAAGACCGCGGAGGTACP-3ratGAGGTACCCAGAACTGCCCTGP-1mouseGATAGTCAGTGGGGGAAACCTCAGP-2mouseCAGCAAAAGAGGGCTGTGTGGTGP-3mouseTGGCCGCCACGAACATCCCATCPpromoter ... IIIfowardATATTCTAGGATCCTGGCTCATTCACTGCTGTCACPintron IIIreverseATATTCTAGGATCCCGGCTTCCCCCTCCCTGCAGPHIF- 1a mutGCAAATTCTTACTGAGCTTTTACTATATGCACAGCPOREGGACGTTCCCACGCTGGGGPORE mutGGTCGTAACCACGCTGGGGPSp1GGCTGTGGGGCGGGCCGGPSp1...

Báo cáo khoa học: Maturation of Pichia pastoris-derived recombinant pro-Der p 1 induced by deglycosylation and by the natural cysteine protease Der p 1 from house dust mite doc

... 15¢)GGGGAGCTCTTAGAGAATGACAACATATGG-3¢pPICZaA5¢cloning primer mature Der p 1 5¢)GGGCTCGAGAAAAGAACTAACGCCTGCAGTATCAAT-3¢Sequence primers used for vector pPICZaA5¢AOX, 3¢AOX and a- factor primer672 ... (data not shown).Proteolytic cleavage of recombinant pro-Der p 1As autocatalytic cleavage was not achieved, enzymaticallyactive natural Der p 1 was evaluated as a tool to inducematuration of ... DIGGlycan Differentiation Kit (Roche Diagnostics GmbH,Mannheim, Germany) using the following lectins: Galanthusnivalis agglutinin, S ambuc us nigra agglutinin, Maackiaamurensis agglutinin, peanut...

Báo cáo khoa học: Characterization of an N6 adenine methyltransferase from Helicobacter pylori strain 26695 which methylates adjacent adenines on the same strand pptx

... TACAATGTACCGGAGATCTATTGATCATGTTACATGGCCTCTAGATAACTAG3 TACAATGTACCGAAGATCTATTGATCATGTTACATGGCTTCTAGATAACTAG4 TACAATGTACCGTGGATCTATTGATCATGTTACATGGCACCTAGATAACTAG5 TACAATGTACCGAGAATCTATTGATCATGTTACATGGCTCTTAGATAACTAG6 TACAATGTACCGAmAGATCTATTGATCATGTTACATGGCTTCTAGATAACTAG7 ... TACAATGTACCG2GGATCTATTGATCATGTTACATGGCTCCTAGATAACTAG10 TACAATGTACTCGAAGCTATCTATTGATCATGTTACATGAGCTTCGATAGATAACTAG11 TACAATGTATCATGAAGTACTCTATTGATCATGTTACATAGTACTTCATGAGATAACTAG12 TACAATGTATCGCGAAGCGCTCTATTGATCATGTTACATAGCGCTTCGCGAGATAACTAG13 ... TACAATGTACCGAmAGATCTATTGATCATGTTACATGGCTTCTAGATAACTAG7 TACAATGTACCGmAAGATCTATTGATCATGTTACATGGCTTCTAGATAACTAG8 TACAATGTACCGmAmAGATCTATTGATCATGTTACATGGCTTCTAGATAACTAG9 TACAATGTACCG2GGATCTATTGATCATGTTACATGGCTCCTAGATAACTAG10...

Báo cáo khoa học: Binding of activated Factor XII to endothelial cells affects its inactivation by the C1-esterase inhibitor pptx

... that the cell-bound and -generated FXIIa and kallikrein areprotected from inactivation by endogenous inhibitors in the plasma. Activation of PPK plays a primary role in initiatingand maintaining ... cleavage product of HK generated by proteolytic attack by kallikrein generated by activation of PPK as a consequense of vessel injury. The activation of FXIIand PPK/HK may start with a local increase ... comparedto inactivating FXIIa in the medium. The inactivationonly slightly affected the dissociation of FXIIa fromHUVEC indicating that C1-INH inactivates cell-boundFXIIa by binding to FXIIa...

Tài liệu Báo cáo khoa học: Phosphorylation of cyclin dependent kinase 4 on tyrosine 17 is mediated by Src family kinases pptx

... 3¢-GTCACAGAGCCACAGTTCCAGCCAGGA-5¢. Codon 305 of C-YES was mutated fromAAA (Lys) to AGA (Arg) with the forward primer: 3¢-GGAACCACGAAAGTAG CAATC AGA ACACTA AAACC A GGTACAATGATGC-5 ¢ . All vector inserts ... 96-wellplate format assay. Each sample contained 2.5 lg of total protein.Values are the average of four samples with error bars indicating the SEM.Phosphorylation of CDK4 by Src family kinases ... ⁄cyclin D kinase activity is com-monly deregulated in cancer. The majority of cancerscontain at least one genetic alteration that affects the RB pathway [7], and a better understanding of howCDK4...

Báo cáo khoa học: Inhibition of an iron-responsive element/iron regulatory protein-1 complex by ATP binding and hydrolysis docx

... enhanced in the presence of IREBinding to RNA and ATPase activity are characteris-tics of RNA helicases, and RNA binding increases the ATPase activity of these proteins [26]. To test whether the ... IRP-1, again increasing IRE-bindingactivity. It is proposed that the H2O2-mediated conver-sion from cytosolic aconitase to an IRE-bindingprotein is a result of a signaling pathway rather than of ... Site-directedmutational analysis for the ATP binding of DnaA pro-tein. Functions of two conserved amino acids (Lys-178and Asp-235) located in the ATP-binding domain of DnaA protein in vitro and in vivo. J Biol...

Báo cáo khoa học: Interaction of G-rich GT oligonucleotides with nuclearassociated eEF1A is correlated with their antiproliferative effect in haematopoietic human cancer cell lines potx

... a major contaminant of eEF 1A protein can be excluded by MALDI TOF analysis of the Coomassie blue bandextract [21] and by the absence of a correspondingnucleolin signal in western-blotting of ... oligodeoxy-nucleotides interacting with the SH2 domain of Stat3, a protein encoded by a proto-oncogene that is activa-ted in many human cancer cells, represent a novel class of aptameric therapeutic agents for the ... presence of a high molar excess of BSA remaining in the recovery buffer. Therefore, a ﬁxed aliquot of the proteinwas incubated with 1 ng of the indicated probes. After30 min incubation at room...

Báo cáo khoa học: Mechanisms of amyloid ﬁbril self-assembly and inhibition Model short peptides as a key research tool pptx

... crucial role in the fibrillization process [27]. The results of a systematic alanine-scan of a shorterIAPP fragment (Table 1) indicated that other thanphenylalanine, any amino acid within the fragmentcould ... important informa-tion of the role of aromatic moieties in amyloid fibrilformation [36–41]. A parameter-free model based on the mathematical analysis of many peptide fragmentsand their analogues ... because of a gradualincrease in life expectancy. The genuine understanding of the mechanisms leading to the formation of amyloidfibrils and its inhibition is therefore of high clinicalimportance....

Báo cáo khoa học: Folding of epidermal growth factor-like repeats from human tenascin studied through a sequence frame-shift approach pdf

... 1020304050600102030405060area (%)area (%)time (min) A Fig. 4. Oxidative folding kinetics. (A) Disappearance of the startingproduct (%, area of the initial reduced form with respect to the totalintegrated area) ... repeats display-ing a different pattern in the cysteine spacing. The oxidative folding of frame-shifted peptides simulates, in a way, the mispairing that would occur whether inter-rather than intra-repeat ... structureelements. A qualitative analysis of the spectra suggests the absence of helical structure, and a dominant component of irregular structure in all the peptides. A quantitative analysis of secondary...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Chuong 2 nhận dạng rui ro BT Tieng anh 6 UNIT 2 Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ