0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Autoregulatory binding sites in the zebrafish six3a promoter region define a new recognition sequence for Six3 proteins potx

Báo cáo khoa học: Autoregulatory binding sites in the zebrafish six3a promoter region define a new recognition sequence for Six3 proteins potx

Báo cáo khoa học: Autoregulatory binding sites in the zebrafish six3a promoter region define a new recognition sequence for Six3 proteins potx

... similar binding affinities tothat of Six 3a (Fig. 6). These findings indicate a highdegree of overlap in binding sites for Six 3a, Six3b,and Six7, and that they might compete for the same recognition ... Identification of ATTA core flankingnucleotides critical for Six 3a HD binding. (A) EMSAs with the Six 3a HD and biotin-labelled a1 probe. Unlabelled fragments with a single point mutation in a1 (table) wereused ... Overview of the DNA sequence of the six 3a promoter region showing the positions of sites contain-ing ATTA (and TAAT) core sequences.Fig. S2. Sites within the six 3a promoter containingoppositely...
  • 15
  • 349
  • 0
Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt

Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt

... The Authors Journal compilation ª 2010 FEBS 4561Carbohydrate binding sites in Candida albicansexo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’at the active site entranceWayne M. Patrick1,2,*, ... Phe144 apparently in a position to interactwith the b-1,3-glucan substrate. Strikingly, the carbo-hydrate -binding module CBM 4-2 of a bacterial lamin-arinase, which recognizes the same substrate(laminarin) ... sugar residue (labelled +2).(B) Cut-away view of L3 binding in the active site pocket showing the Phe-Phe clamp and the F22 9A mutation. Carbohydrate binding subsites are labelled )1, +1 and...
  • 13
  • 498
  • 0
Báo cáo khoa học: Polysaccharide binding sites in hyaluronate lyase – crystal structures of native phage–encoded hyaluronate lyase and its complexes with ascorbic acid and lactose docx

Báo cáo khoa học: Polysaccharide binding sites in hyaluronate lyase – crystal structures of native phage–encoded hyaluronate lyase and its complexes with ascorbic acid and lactose docx

... thatascorbic acid may bind at the saccharide binding site.Therefore, it may act as a protective factor for the hosttissue hyaluronan because these tissues are notdegraded by the hyaluronate ... acidagainst HylP2. For the first time, the present studyprovides insight into the inhibitor binding sites in HylP2 and postulates the substrate binding regions in the bacteriophage enzyme as a result ... of ascorbic acidbeing structurally similar to the glucuronate residues in hyaluronan polysaccharide.Ligand binding in HylP2To define the binding surface with residues that areimportant in recognition, ...
  • 11
  • 517
  • 0
Báo cáo khoa học: Starch-binding domains in the CBM45 family – low-affinity domains from glucan, water dikinase and a-amylase involved in plastidial starch metabolism pptx

Báo cáo khoa học: Starch-binding domains in the CBM45 family – low-affinity domains from glucan, water dikinase and a-amylase involved in plastidial starch metabolism pptx

... 2011)doi:10.1111/j.1742-4658.2011.08043.xStarch -binding domains are noncatalytic carbohydrate -binding modulesthat mediate binding to granular starch. The starch -binding domains from the carbohydrate -binding module family 45 ... represent the integrated binding heat of the data in the top panel, and the fullline is the fit of a one-site binding model to the integrated binding data. The experiment was carried out at 25 °C by titrating ... 1185Starch -binding domains in the CBM45 family – low-affinitydomains from glucan, water dikinase and a- amylaseinvolved in plastidial starch metabolismMikkel A. Glaring1,2, Martin J. Baumann1, Maher Abou...
  • 11
  • 634
  • 0
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

... 5¢-TTCTGGGCCCCCAATTGCGGCGCGGGCCTCGAA-3¢ for E19 0A, 5¢-ATTCCGGTTACTTTCGCGGCCCGCGCCCAAATT-3¢ and 5¢-AATTTGGGCGCGGGCCGCGAAAGTAACCGGAAT-3¢ for E19 0A, 5¢-CAAATTGGGGGCCCAGCAGCTGGGAAGTCTGAA-3¢ and 5¢-TTCAGACTTCCCAGCTGCTGGGCCCCCAATTTG-3¢ ... between the A and B chainsof insulin, resulting in the aggregation and precipita-tion of the B chain. Reduction stress assays are advan-tageous over thermal stress assays as they can beperformed ... domain, which is flanked byregions of variable sequence and length: the N-terminal domain and the C-terminal extension. Although the two domains are known to be involved in the organization of the...
  • 14
  • 417
  • 0
Báo cáo khoa học: Activator-binding domains of the SWI ⁄ SNF chromatin remodeling complex characterized in vitro are required for its recruitment to promoters in vivo pot

Báo cáo khoa học: Activator-binding domains of the SWI ⁄ SNF chromatin remodeling complex characterized in vitro are required for its recruitment to promoters in vivo pot

... to GAL1-10 andGAL2 is reduced by approximately 50% in strainslacking either the Swi1 or the Snf5 activator -binding domains (Fig. 3). In the strain lacking both activator- binding domains, the ... together,these findings suggest that the predominant coactivatingrole of SWI ⁄ SNF may be at steps downstream of activa-tor binding rather than as a facilitator of activator bind-ing, although these ... lackingboth the Swi1 and Snf5 activator -binding domains.Recruitment of the SWI ⁄ SNF complex via activatorinteractions with these activator -binding domains isthus critical for normal galactose induction...
  • 9
  • 539
  • 0
Báo cáo khoa học: Inactivating pentapeptide insertions in the fission yeast replication factor C subunit Rfc2 cluster near the ATP-binding site and arginine finger motif docx

Báo cáo khoa học: Inactivating pentapeptide insertions in the fission yeast replication factor C subunit Rfc2 cluster near the ATP-binding site and arginine finger motif docx

... 4807 A Fig. 2. Location of insertion sites in conserved regions. Location of insertions in N-terminal AAA+domain (domain I, shown in A) , centraldomain (domain II, B) and C-terminal collar domain ... Rfc4(RFC-B). The side chain of the arginine is referred toas an arginine finger and the finger protrudes into the ATP -binding site of the neighbouring subunit. The exact biochemical roles of the arginine ... proteinbound to ATP-cS [9]. The locations of the eight inactivating insertion mutations areindicated by the blue circles. The locationsof the three arginines implicated in DNA binding are shown...
  • 11
  • 502
  • 0
Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc

Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc

... of the senR gene and the in- frame fusion with the His-tag codons.Purification of the fusion proteins An E. coli XL1-Blue transformant containing the pASKS2or pASKS2H19 9A plasmid was inoculated ... sites. FragmentPrimername Primer sequence (5¢-to3¢; restriction sites in bold type) A IHinfor CATGAAGCTTGCATGGCCGGGGCC (located upstream of furS)IEcorev CGAGAATTCGAAAACGAACGGTGC (located upstream of furS and ending ... downstream of the start codon of furS)C IIHinfor GGTAAGCTTCTCCAGGGTCAGATG (located upstream of hbpS)IIEcorev GCCGAATTCTCCTCAGCATGTCCAG (located upstream of hbpS and ending at the 5¢-end of binding...
  • 14
  • 428
  • 0
Báo cáo khoa học: Large conformational changes in the Escherichia coli tryptophan synthase b2 subunit upon pyridoxal 5¢-phosphate binding pot

Báo cáo khoa học: Large conformational changes in the Escherichia coli tryptophan synthase b2 subunit upon pyridoxal 5¢-phosphate binding pot

... 1184–1192.18 Yamagata Y, Ogasahara K, Hioki Y, Lee SJ, Nakaga-wa A, Nakamura H, Ishida M, Kuramitsu S & YutaniK (2001) Entropic stabilization of the tryptophansynthase a- subunit from a hyperthermophile, ... uponPLP binding. The conformational changes in the peak4 region near Thr319 are also affected by alterationstransmitted from the peak 3 region. The C terminus of the long-loop and the N terminus ... other proteins? Protein Eng 14, 127–134.36 Magalhaes A, Maigret B, Hoflack J, Gomes JN &Scheraga HA (1994) Contribution of unusual arginine-arginine short-range interactions to stabilization...
  • 14
  • 311
  • 0
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt

Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt

... the same position as zinc, indicating that the proteins binding zinc in these fractions scarcelycontained any aromatic amino acid residues. Thissuggests that the proteins are metallothioneins,well-known ... toMYP. The elution patterns of zinc were similar in the ovary and testis, but the zinc peak in the immatureovary was larger than that in the immature testis,Zinc -binding protein in the sea urchin ... widely in vertebratesand invertebrates [25–27]. Mammalian transferrin canalso bind various trace metals, including manganese,copper, and zinc, although the affinity of transferrin for these trace...
  • 14
  • 442
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ