Báo cáo Y học: Shb links SLP-76 and Vav with the CD3 complex in Jurkat T cells pptx
Báo cáo Y học: Shb links SLP-76 and Vav with the CD3 complex in Jurkat T cells pptx
... the
total amount of SLP-76 in the CD3 treated lanes. The
75-kDa protein comigrated exactly with SLP-76. These
results indicate that both the SH2 domain and the PTB-
Tyr region of Shb, are vital ... mutation in the SH2
domain affects the co-immunoprecipitation of several
tyrosine phosphorylated proteins
To further investigate the protein-interactions of the Shb...
Báo cáo y học: "Use of chinese and western over-the-counter medications in Hong Kong"
... community pharmacists
might be the only point of contact when they had
minor aliments. Therefore, there is a need in promoting
and extending the roles of the western medicine com-
munity pharmacists ... medications. Patterns of OTC uses reflect the characteristics of populations who rely on community pharma-
cists and Chinese medicine retailers as their main point of contact wi...
Báo cáo Y học: Cloning, chromosomal localization and characterization of the murine mucin gene orthologous to human MUC4 pdf
... 180
ccgacctcagGCCTC CATAGgtgacacctc 9 145 1
Mouse 10 117
ctctttgcagGTTGG GTTTGgtaagtatct 10 681 1
Human 10 114/126
d
cttgtttcagGTCGC GTTGGgtgatctcaa 10 801 1
Mouse 11 120
ttcttcacagATGAG GCCCGgtgagcatca ... within the repeat region (see further) to
obtain the cDNA corresponding to the end of the repeat
region. The sense oligonucleotide NAU972 (5¢-GAGCTGC
CTGTGTTCTTGCCTCCT-3¢) was de...
Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt
... of
one strand: 1 (bio-AAAAATGGGTCAACGTGGGCAA
AGATGTCCTAGCAATGTAATCGTCTATGACGTT),
2 ( GTCGGATCCTCTAGACAGCTCCATGTTCACTG
GCACTGGTAGAATTCGGC), 3 (TGCCGAATTCTA
CCAGTGCCAGTGAAGGACATCTTTGCCCACGTTG
ACCC), ... protein. The
results suggest that the m odified pin in uences the a bility to
bind duplex DNA and is consistent with observations by
Ingleston et al. [12] showing that mutations in E...
Báo cáo Y học: Effect of ibuprofen and warfarin on the allosteric properties of haem– human serum albumin A spectroscopic study potx
... perturbation of the electronic absorbance
properties of the chromophore without affecting the
coordination number or the spin state of the haem-iron,
and the quenching of the
1
H-NMR relaxivity. ... linked by extended random coils. It is thus
reasonable to hypothesize allosteric conformational tran-
sition(s) occurring in HSA upon ligand binding. Note that
the flexibility o...
Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx
... ribozyme in Mn
2+
is that binding of
the cosubstrate to its site induces a conformational
change in the RNA that inhibits Mn
2+
binding at
another inhibitory site(s). It may be relevant that
in vitro-evolved ... trans-
reaction [10] that involves the free intron reacting with
5.8S rRNA (not shown). Together, these data sugges-
ted that inhibition by Mn
2+
probably involved the...
Báo cáo y học: "Lifetime health effects and medical costs of integrated stroke services - a non-randomized controlled cluster-trial based life table approach"
... The
incidence rates in the Netherlands have only fluctuated
around the same level since the early 1990 s. Yet, mor-
tality has been steadily declining [1].
The burden of stroke in the Netherlands is ... as
defined ex ante, and was the only one cost-effective in
the first six months after stroke in the EDISSE trial,
while the other did not comply to these criteria...
Báo cáo y học: "2009 H1N1 Influenza and Experience in Three Critical Care Unit"
... time from the onset of illness to the
initiation of antiviral therapy was 7.4±4.17 days
(range, 1 to 22 days); 2 of the patients received anti-
viral therapy within 48 hours after the onset ...
findings are consistent with these reports. In our data
and in other studies, death was occurred mostly
young critically ill patients (1, 13, 14). But, the risk of
death increase...
Báo cáo y học: "Long Term Persistence of IgE Anti-Influenza Virus Antibodies in Pediatric and Adult Serum Post Vaccination with Influenza Virus Vaccine"
... al-
lergy to egg and antibiotics. At the time of study, the
subjects had not received allergy therapy, and were
not being treated with any medication. Subjects did
not have a past history of ... able to mediate antibody depend-
ent cell mediated cytotoxicity against cancer cells in
vitro. These responses were not correlated with total
serum IgE levels. We therefore specul...
Từ khóa:
- báo cáo y học
- báo cáo y học cổ truyền
- mẫu báo cáo y học cổ truyền
- bao cao y hoc colchicin
- phan ban luan trong bao cao y hoc co truyen
- determination of metal interactions with the chaperone hspa5 in human astrocytoma cells and rat astrocyte primary cultures
- báo cáo khoa học y học
- báo cáo y tế học đường
- mẫu báo cáo y tế học đường
- báo cáo y tế học đường cuối năm
- báo cáo y tế học đường năm 2012
- báo cáo y tế học đường trường mầm non
- biểu mẫu báo cáo y tế trường học
- báo cáo y tế học đường trường tiểu học
- báo cáo y tế trường tiểu học
- Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại
- Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp
- đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN
- NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE
- Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long
- Phát hiện xâm nhập dựa trên thuật toán k means
- Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế
- Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)
- Thơ nôm tứ tuyệt trào phúng hồ xuân hương
- Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX
- Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật