0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "WHAT A TYPE OF INTERACTION IS IT TOBE HT" potx

Báo cáo khoa học:

Báo cáo khoa học: "WHAT A TYPE OF INTERACTION IS IT TOBE HT" potx

... least some aspects of each party's partic- ipation by collaboration of the parties. For the "talk" part of person-person interaction, a/ the major vehicle for this "interactionality" ... less (what we call micro-pauses) can, and regularly do, have substantial sequential and interactional conse- quences. The character of the talk after them is regu- larly different, or is subject ... interactants impacts on this aspect of the exchange of talk. It is one reason for wondering whether retention of ordinary conversation as the target of this enterprise is appro- priate. For...
  • 2
  • 301
  • 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... Miyazawa K, Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (1989) Molecular cloningand sequence analysis of cDNA for human hepatocytegrowth ... Technology, Nagatsuta,Midori-ku, Yokohama, Japan2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroduction Type II transmembrane ... The IC50valuewas calculated using the graphpad prism software (Graph-Pad Software, San Diego, CA, USA).Binding assayHAI-1–NK1 or HAI-1–NK1LK2 was mixed with variousconcentrations of TMPRSS13...
  • 13
  • 641
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

... Commentability is a feature that often distinguishes a single marker within a se- mantic class in that it can be negated or fo- cused on by scalar particles (e.g., in German, the causal weil ... words are assigned to the realm of the lexicon, whereas function words are treated as a part of grammar. For dealing with discourse markers, we do not regard this distinction as particularly ... which are traditionally treated as function words belonging to the realm of grammar rather than to the lexicon. But for a single discourse relation there is often a set of similar markers, allowing...
  • 5
  • 528
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "TOWARDS A THEORY OF COMPREHENSION OF DECLARATIVE CONTEXTS " docx

... understanding of human actions, although~ naturally there are aspects that are common. An important characteristic of these contexts is the predominance of descriptive predicates and verbs ... incorporation in our model of Kant's distinction between concepts as a system of rules and concepts as an abstract representation (an epistemic notion that is absent in Schank and his collobarators' ... activate the input specialist. The recognition of concepts is as follows: Each time that a new sentence is going to be read, a global variable RECOG is initialized to NIL. Once a nominal...
  • 8
  • 323
  • 0
Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf

Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf

... AATCCCGGGTTACTTTAGTTTATCTTTGCCG SmaIrFnBPB163–463F GGGGGATCCGGTACAGATGTAACAAATAAAG BamHIrFnBPB163–463R ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG SmaIrFnBPB163–308F GGGGGATCCGGTACAGATGTAACAAATAAAG BamHIrFnBPB163–308R ... CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA SmaIrFnBPB309–480F CCCGGATCCTATTTAGGTGGAGTTAGAGATAAT BamHIrFnBPB309–480R AATCCCGGGTTACTTTAGTTTATCTTTGCCG SmaIrFnBPB163–480NF F GAATTATCTTTAGCTCTAGCTATTGATCCrFnBPB163–480NF ... GAATTATCTTTAGCTCTAGCTATTGATCCrFnBPB163–480NF F GGATCAATAGCTAGAGCTAAAGATAATTCFnBPB(–142–480)F GCAGAATTCGTCGGCTTGAAATACGCTG EcoRIFnBPB(–142–480)R AATGGATCCTTACTTTAGTTTATCTTTGCCG BamHIFnBPB(388–980)F CCCAAGCTTGATGATGTCAGC Hind...
  • 13
  • 514
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Creating a Corpus of Parse-Annotated Questions" docx

... question mate-rial is described in Judge et al. (2005). The re-search established that even a small amount of ad-ditional training data can give a substantial im-provement in question analysis in ... summarises the bootstrapping al-gorithm. A section of raw data is parsed. Theparser output is then manually corrected, andadded to the parser’s training corpus. A new gram-mar is then extracted, ... http://www.cis.upenn.edu/∼dbikel/software.html#stat-parserwere being produced at an average rate of 40 treesper day. During the later stages of the project thishad changed dramatically. The quality of treesfrom the parser was much...
  • 8
  • 405
  • 0
Báo cáo khoa học: Macrocypins, a family of cysteine protease inhibitors from the basidiomycete Macrolepiota procera pot

Báo cáo khoa học: Macrocypins, a family of cysteine protease inhibitors from the basidiomycete Macrolepiota procera pot

... micromolar range. The aspartic prote-ase pepsin was not inhibited by natural or recombinantmacrocypins.The ability of natural and recombinant clitocypins[6] to inhibit cathepsins V, S and B was also ... rateconstants of association, but weaker inhibitors of cathepsin L, mainly because of increased rate constants of dissociation. Cathepsins S and K are inhibited bymacrocypins with Kivalues in the nanomolar ... bacteria to humans. They play impor-tant roles in many facets of physiology, anddysregulation of proteolytic activity can lead to a variety of pathologies, including cancer, rheumatoid arthritis,osteoarthritis...
  • 12
  • 368
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Generating a Table-of-Contents" pptx

... Table -of- ContentsS.R.K. Branavan, Pawan Deshpande and Regina BarzilayMassachusetts Institute of Technology{branavan, pawand, regina}@csail.mit.eduAbstractThis paper presents a method for the auto-matic ... Most of these approaches are tailored to a par-1The code and feature vector data forour model and the baselines are available athttp://people.csail.mit.edu/branavan/code/toc.ticular domain, ... hierarchical discriminativeapproach for table -of- contents generation. Figure 1shows a fragment of a table -of- contents automat-ically generated by this algorithm. Our methodhas two important points...
  • 8
  • 353
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Toward a Redefinition of Yea/No Questions" pot

... are entailed. Horn called this phenomenon scalar predleation, and Gazdar {Gazdar, 1979) later used a variation as the basis for a phenomenon he termed sea/at quantity irrtp[ieature. Here a much ... negating the lowest deniable scalar. In such a denial a speaker may implicate his affirmation or ignorance of lower scalars. So, in exchanges like { 9a) , a value higher than a queried value ... make. B. Scalar Impllcature While scalar predication provides a principled explanation for {6), a revised and extended notion of aea/ar irrtplieature can account for a much larger class...
  • 4
  • 331
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Representing a System of Lexical Types Using Default Unification" pdf

... tions that are able to capture linguistic regulari- ties about classes of items that behave similarly. This idea is employed in Pollard and Sag's (1987) sketch of an HPSG lexicon as a monotonic ... specification of the trans type is: (2) trans type: [SUBCAT:<TAIL: /e~list>]. HEAD: rip, TAIL: TAIL: Similarly, the instances and subtypes of trans inherit from intrans all the attributes ... organised as unrelated lists, there is a significant loss of generalisation and an increase in redundancy. Alternatively, it is possible to use inheritance networks, which provide representa-...
  • 4
  • 285
  • 0

Xem thêm

Từ khóa: tuyên tập cac bao cao khoa học hội nghị khoa học địa i apos abáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ