0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx

Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx

Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx

... Sialylated LPS in Haemophilus in uenzae (Eur. J. Biochem. 269) 4019 Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus ... lic 2A, RM118lpsA and RM118lgtF before and after treatment with neuraminidase (as indicated by – and +, respectively). The sialylated tetrasaccharide-containing glycoformsare indicated by an asterisk. ... laboratory indicatethat the ability of acapsular strains of H. in uenzae toelaborate sialylated glycoforms can confer serumresistance in model systems. In the study of Hood et al.[11], a...
  • 11
  • 579
  • 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... signal pep-tide is shadowed and the mature peptide isunderlined. The polyA signal AATAAA in the 3¢-UTR is also underlined. The cDNA of con-omarphin has been deposited in the Gen-bank database ... M, Teramoto T, Kumagaye KY, Nakajima K,Watanabe T, Kawai T, Kawakami Y, Niidome T,Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin-TK containing D-serine at position 46, but not syn-thetic ... availableonline:Fig. S1. Natural and synthetic conomarphin with alll-amino acids on HPLC.Fig. S2. The fragments of natural conomarphin (A) and the synthetic l-Phe13-conomarphin (B) cleaved...
  • 12
  • 616
  • 0
Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx

Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx

... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKABacp19k VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSLBicp19k AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV130 ... Masahiro Nakano1, Satoru Matsuda1, Naoko Inoue2, Satoru Kanai2,Naho Kitamura3, Takashi Nishino3 and Kei Kamino11 Marine Biotechnology Institute, Iwate, Japan2 Pharma Design, Inc., ... (R.U.)Au:ASWAu:BufferHPA:ASWFig. 3. Typical SPR analyses on polycrystalline gold and alkylated gold. The arrows and thick arrows indicate the starts of sample loading(2 lM) and washing by the...
  • 11
  • 488
  • 0
Báo cáo khoa học: Identification and biochemical characterization of the Anopheles gambiae 3-hydroxykynurenine transaminase pot

Báo cáo khoa học: Identification and biochemical characterization of the Anopheles gambiae 3-hydroxykynurenine transaminase pot

... tgttacggtagcggtacctgtttgccgaagtgttgtcagcttggtgttctagagtgagggtataactaacgctgccctaaagttggaagaaggggaataacgtaaacgacacacctcagtgacattgtgcgaattgtcccgtattgtattaacttactgaaagtgctgatacaatgaagttcacgccgccccctgcatcgctaMKFTPPPASLcgcaatcctttaatcattccggaaaagataatgatgggccctggaccgtccaactgctcaaagcgggtgctgactgccatgactaacaccRNPLIIPEKIMMGPGPSNCSKRVLTAMTNTgtgctgagcaacttccacgctgaattgttccgaacgatggacgaggtcaaggatggcttgcggtacatttttcagacagaaaaccgggccVLSNFHAELFRTMDEVKDGLRYIFQTENRAactatgtgcgtaagcggttccgcacacgcgggaatggaagctatgctgagcaatctgcttgaagagggcgatcgagtgctgatcgcggttTMCVSGSAHAGMEAMLSNLLEEGDRVLIAVaacggaatttgggcagagcgtgccgtcgaaatgtctgagcgatacggtgccgatgttcgaacgattgagggccctccggaccgcccgttcNGIWAERAVEMSERYGADVRTIEGPPDRPFagtttggaaacattggccagagccatcgaactgcatcaacccaagtgtctgttcctgacgcacggtgactcatcaagtggtctgctgcagSLETLARAIELHQPKCLFLTHGDSSSGLLQccgctggaaggtgtaggccagatttgtcaccagcacgactgtttgctcatcgttgatgccgtggcttcgctgtgcggtgtgccattttatPLEGVGQICHQHDCLLIVDAVASLCGVPFYatggataaatgggagattgatgccgtctatactggagcgcaaaaggtgctaggtgcgcctcctggtatcactcccatttctataagcccgMDKWEIDAVYTGAQKVLGAPPGITPISISPaaagcactggatgttattcgaaatcgtcgtacaaaatcgaaagtattttactgggatttactgctgcttggcaattattggggctgttatKALDVIRNRRTKSKVFYWDLLLLGNYWGCYgatgaaccaaaacgttatcaccatactgtcgcatcgaacttaatatttgctctgcgggaagcattggctcaaattgcggaagaaggactgDEPKRYHHTVASNLIFALREALAQIAEEGLgaaaatcagatcaaacgccgcatcgaatgtgcccaaatcttgtacgaagggcttggtaagatgggactcgatattttcgtgaaagaccccENQIKRRIECAQILYEGLGKMGLDIFVKDPagacatcgcctgcccaccgtaactggtattatgattccgaaaggtgttgactggtggaaagtttcacaatacgccatgaacaatttttcgRHRLPTVTGIMIPKGVDWWKVSQYAMNNFSttagaagtacaaggaggacttggacctacgtttggaaaagcatggcgtgtgggtattatgggcgaatgctcaacggtacaaaaaatacaaLEVQGGLGPTFGKAWRVGIMGECSTVQKIQttctatctatatggctttaaggaatcactcaaagccacgcatcccgactatattttcgaggaaagtaatggatttcactagacgaaacttFYLYGFKESLKATHPDYIFEESNGFHaaacaatgcatcaatgtattattgccg ... tgttacggtagcggtacctgtttgccgaagtgttgtcagcttggtgttctagagtgagggtataactaacgctgccctaaagttggaagaaggggaataacgtaaacgacacacctcagtgacattgtgcgaattgtcccgtattgtattaacttactgaaagtgctgatacaatgaagttcacgccgccccctgcatcgctaMKFTPPPASLcgcaatcctttaatcattccggaaaagataatgatgggccctggaccgtccaactgctcaaagcgggtgctgactgccatgactaacaccRNPLIIPEKIMMGPGPSNCSKRVLTAMTNTgtgctgagcaacttccacgctgaattgttccgaacgatggacgaggtcaaggatggcttgcggtacatttttcagacagaaaaccgggccVLSNFHAELFRTMDEVKDGLRYIFQTENRAactatgtgcgtaagcggttccgcacacgcgggaatggaagctatgctgagcaatctgcttgaagagggcgatcgagtgctgatcgcggttTMCVSGSAHAGMEAMLSNLLEEGDRVLIAVaacggaatttgggcagagcgtgccgtcgaaatgtctgagcgatacggtgccgatgttcgaacgattgagggccctccggaccgcccgttcNGIWAERAVEMSERYGADVRTIEGPPDRPFagtttggaaacattggccagagccatcgaactgcatcaacccaagtgtctgttcctgacgcacggtgactcatcaagtggtctgctgcagSLETLARAIELHQPKCLFLTHGDSSSGLLQccgctggaaggtgtaggccagatttgtcaccagcacgactgtttgctcatcgttgatgccgtggcttcgctgtgcggtgtgccattttatPLEGVGQICHQHDCLLIVDAVASLCGVPFYatggataaatgggagattgatgccgtctatactggagcgcaaaaggtgctaggtgcgcctcctggtatcactcccatttctataagcccgMDKWEIDAVYTGAQKVLGAPPGITPISISPaaagcactggatgttattcgaaatcgtcgtacaaaatcgaaagtattttactgggatttactgctgcttggcaattattggggctgttatKALDVIRNRRTKSKVFYWDLLLLGNYWGCYgatgaaccaaaacgttatcaccatactgtcgcatcgaacttaatatttgctctgcgggaagcattggctcaaattgcggaagaaggactgDEPKRYHHTVASNLIFALREALAQIAEEGLgaaaatcagatcaaacgccgcatcgaatgtgcccaaatcttgtacgaagggcttggtaagatgggactcgatattttcgtgaaagaccccENQIKRRIECAQILYEGLGKMGLDIFVKDPagacatcgcctgcccaccgtaactggtattatgattccgaaaggtgttgactggtggaaagtttcacaatacgccatgaacaatttttcgRHRLPTVTGIMIPKGVDWWKVSQYAMNNFSttagaagtacaaggaggacttggacctacgtttggaaaagcatggcgtgtgggtattatgggcgaatgctcaacggtacaaaaaatacaaLEVQGGLGPTFGKAWRVGIMGECSTVQKIQttctatctatatggctttaaggaatcactcaaagccacgcatcccgactatattttcgaggaaagtaatggatttcactagacgaaacttFYLYGFKESLKATHPDYIFEESNGFHaaacaatgcatcaatgtattattgccg ... tgttacggtagcggtacctgtttgccgaagtgttgtcagcttggtgttctagagtgagggtataactaacgctgccctaaagttggaagaaggggaataacgtaaacgacacacctcagtgacattgtgcgaattgtcccgtattgtattaacttactgaaagtgctgatacaatgaagttcacgccgccccctgcatcgctaMKFTPPPASLcgcaatcctttaatcattccggaaaagataatgatgggccctggaccgtccaactgctcaaagcgggtgctgactgccatgactaacaccRNPLIIPEKIMMGPGPSNCSKRVLTAMTNTgtgctgagcaacttccacgctgaattgttccgaacgatggacgaggtcaaggatggcttgcggtacatttttcagacagaaaaccgggccVLSNFHAELFRTMDEVKDGLRYIFQTENRAactatgtgcgtaagcggttccgcacacgcgggaatggaagctatgctgagcaatctgcttgaagagggcgatcgagtgctgatcgcggttTMCVSGSAHAGMEAMLSNLLEEGDRVLIAVaacggaatttgggcagagcgtgccgtcgaaatgtctgagcgatacggtgccgatgttcgaacgattgagggccctccggaccgcccgttcNGIWAERAVEMSERYGADVRTIEGPPDRPFagtttggaaacattggccagagccatcgaactgcatcaacccaagtgtctgttcctgacgcacggtgactcatcaagtggtctgctgcagSLETLARAIELHQPKCLFLTHGDSSSGLLQccgctggaaggtgtaggccagatttgtcaccagcacgactgtttgctcatcgttgatgccgtggcttcgctgtgcggtgtgccattttatPLEGVGQICHQHDCLLIVDAVASLCGVPFYatggataaatgggagattgatgccgtctatactggagcgcaaaaggtgctaggtgcgcctcctggtatcactcccatttctataagcccgMDKWEIDAVYTGAQKVLGAPPGITPISISPaaagcactggatgttattcgaaatcgtcgtacaaaatcgaaagtattttactgggatttactgctgcttggcaattattggggctgttatKALDVIRNRRTKSKVFYWDLLLLGNYWGCYgatgaaccaaaacgttatcaccatactgtcgcatcgaacttaatatttgctctgcgggaagcattggctcaaattgcggaagaaggactgDEPKRYHHTVASNLIFALREALAQIAEEGLgaaaatcagatcaaacgccgcatcgaatgtgcccaaatcttgtacgaagggcttggtaagatgggactcgatattttcgtgaaagaccccENQIKRRIECAQILYEGLGKMGLDIFVKDPagacatcgcctgcccaccgtaactggtattatgattccgaaaggtgttgactggtggaaagtttcacaatacgccatgaacaatttttcgRHRLPTVTGIMIPKGVDWWKVSQYAMNNFSttagaagtacaaggaggacttggacctacgtttggaaaagcatggcgtgtgggtattatgggcgaatgctcaacggtacaaaaaatacaaLEVQGGLGPTFGKAWRVGIMGECSTVQKIQttctatctatatggctttaaggaatcactcaaagccacgcatcccgactatattttcgaggaaagtaatggatttcactagacgaaacttFYLYGFKESLKATHPDYIFEESNGFHaaacaatgcatcaatgtattattgccg...
  • 10
  • 421
  • 1
Báo cáo khoa học: Identification and functional characterization of an aggregation domain in long myosin light chain kinase ppt

Báo cáo khoa học: Identification and functional characterization of an aggregation domain in long myosin light chain kinase ppt

... N-terminal extension that con-tains several extra structural motifs, including a 2Igdomain at the distal N-terminus and a 4Ig domain and DFRxxL motif at the proximal N-terminus [16,17].These structural ... domainsmay serve as molecular spacers and bind to a diversity of ligands, it is believed that they have important phys-iological and structural significance in cell adhesion and maintenance of ... of 4Ig aggre-gates. To investigate whether other ingredients existed in the aggregate, we stained the aggregates in cells withphalloidin, and this revealed the presence of strongactin-staining...
  • 12
  • 396
  • 0
Báo cáo khoa học: Identification and characterization of oxidized human serum albumin A slight structural change impairs its ligand-binding and antioxidant functions pptx

Báo cáo khoa học: Identification and characterization of oxidized human serum albumin A slight structural change impairs its ligand-binding and antioxidant functions pptx

... humanserum albumin A slight structural change impairs its ligand-binding and antioxidantfunctionsAsami Kawakami1,*, Kazuyuki Kubota2,*, Naoyuki Yamada2, Uno Tagami2, Kenji Takehana1,Ichiro ... Sonaka1, Eiichiro Suzuki2 and Kazuo Hirayama21 Pharmaceutical Research Laboratories, Ajinomoto Co. Inc., Kawasaki, Japan2 Institute of Life Science, Ajinomoto Co. Inc., Kawasaki, JapanHuman ... Divi-sion of Pharmacology, Kanagawa Dental College, forvaluable advice on ESR analysis. We also thank DrItsuya Tanabe and other researchers in AjinomotoCo., Inc., for technical advice and helpful...
  • 12
  • 479
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... protein all-alpha domain, STATprotein DNA-binding domain and SH2 domain of stat6, and the zinc-finger domain, leucine-zipperdomain and fork-head domain of foxp3. In addition,for stat6 and foxp3, ... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACEZf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACEZf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial ... 3¢-RACEZf3¢stat6-F2 CGGTAGTCAGGAAATCAATGCC 3¢-RACEZf5¢stat6-R1 CCATGTCTGCAGATGGTCGAGG 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC...
  • 20
  • 689
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

... parasite.SmSmad1B demonstrates sequence motifs that arecommon to R-Smads, such as a nuclear localizationsignal and a DNA-binding domain in the MH1 domain and the L3 loop, and the C-terminal, ... size in bp and domain size in amino acids are indicated at the bottom of each schematic representation of the gene, cDNA, and protein, respectively. The schematic representation and the amino acidsequence ... worm pairing and male–female interac-tions. In contrast, the expression levels of SmSmad2 areat their highest in 35 day worms and adults [6].SmSmad1B was also localized in the vitellaria and reproductive...
  • 19
  • 653
  • 0
Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

... GTGATCCCGATTATTCTGTGTGTT Cloning of sipWW9 GGCGATGTCATCACTTTTACACAA Cloning of sipWW10 AACACACAGAATAATCGGGATCAC Cloning of sipWW11 GAGAATTCAAAAGAAAGCGGGGAAGAA Construction of pOpacWhW12 CGAGATCTTGTGGACATGGTCCCGTTTC ... TTGAARAARMGNTTYTGGTTYYTNGC Cloning of sipVV2 GTNTTYATNGTYTAYAARGTNGARGG Cloning of sipVV3 TCNGCRTCNSWNATNACNCCNACNAT Cloning of sipVV4 GCCAAAACAACGATAAGCACGCC Cloning of sipVV5 GGATTCATGCTGATTCCTTCGAC ... GGATTCATGCTGATTCCTTCGAC Cloning of sipVV6 ACTTGGCACTACACCGCACCTCATGCG Cloning of sipVV7 ATTTCGTGATTGGCGACAACCGC Cloning of sipVV8 GAGAATTCCGGAGGGGGACAGGAATCTTG Construction of pOpacVhV9 GCAGATCTCTTGGCGTATGATTCACTGAT...
  • 12
  • 595
  • 0
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

... domain B Ligand binding domain Fig. 1. Sequence alignment. (A) Alignment of DNA binding domain (C domain) and itsC-terminal extension. (B) Alignment of ligandbinding domain (E domain) (after ... motifs binding to the cis-regulatory region of a target gene, and a conserved ligand-binding domain(LBD) that is involved in transcriptional activation of the target gene via ligand and coregulator ... gene assay in in vivo results.Experimental proceduresParasites The NMRI strain of S. mansoni was maintained in snails(Biomphalaria glabrata) and Syrian golden hamsters(Mesocricetus auratus...
  • 16
  • 542
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI