0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Compounding and derivational morphology in a finite-state setting" pptx

Báo cáo khoa học:

Báo cáo khoa học: "Compounding and derivational morphology in a finite-state setting" pptx

... linguistic information will be availableto address derivation/compounding. Since the nec-essary generative capacity is available in the syntac-tic grammar anyway, it seems reasonable to leavemore ... Compounding and derivational morphology in a finite-state settingJonas KuhnDepartment of LinguisticsThe University of Texas at Austin1 University Station, B5100Austin, TX 78712-11196, USAjonask@mail.utexas.eduAbstractThis ... part-of-speech category and morphosyntactic agreement in- formation, it is certainly important for informationextraction, information retrieval, and higher-leveltasks like machine translation.4An...
  • 8
  • 353
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "LEXICAL AND SYNTACTIC RULES IN A TREE ADJOINING GRAMMAR" pdf

... "the' and "bucket' for (1, 'bury', 'the' and 'hatchet' for ¢2, and 'take', 'into' and 'account' for ,t3. The idiomatic ... LEXICAL AND SYNTACTIC RULES IN A TREE ADJOINING GRAMMAR Anne Abeill6* LADL and UFRL University of Paris 7-Jussieu abeille@zeta.ibp.fr ABSTRACT according to this definition 2. Each elementary ... demande la lune # Ouelle lune demande-t-elle ? C'est la lune qu'clle demande ! # Jeanne demande la lune et Paule la demande aussi. (Jeanne is askin~ for the moon and i'm asking...
  • 7
  • 472
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "PARSING AND DERIVATIONAL EQUIVALENCE" pptx

... and suggestions in relation to this material, and Inge Bethke and Henk Zee- vat for reading a late draft. All errors are our own. The work was carried out by the alphabetically first author ... kind in a grammar undermines a methodological assump- tion of derivational uniqueness. Combinatory Logic and Combina- tory Grammar Combinatory logic (CL; Curry and Feys, 1958; Curry, Hindley ... John') However the grammar now exhibits derivational equivalence, with different derivations assigning the same meaning. In general a sequence A1 /A2 +A2 /A3 9 .A3 /A4 9."'9"An...
  • 9
  • 341
  • 0
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

... 4038–4049.20 Nanba H, Yajima K, Takano M, Yamada Y, IkenakaY & Takahashi S (1997) Process for producing d-N-car-bamoyl -a- amino acid. European Patent ApplicationNo. EP080113 1A1 .21 Abendroth J, ... evolution and structural analysis of N-carbamoyl-d-amino acidamidohydrolase provide insights into recombinantY. Cai et al. A novel high-activity D-hydantoinase from Jannaschia sp. CCS1FEBS Journal ... of Shanghai, Chinese Academy of Sciences, Shanghai, ChinaOptically pure d-orl-amino acids are used as inter-mediates in several industries. d-amino acids areinvolved in the synthesis of antibiotics,...
  • 14
  • 621
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... entericaTyphimurum strain IFO12529 genomic DNA as the templateusing Deep Vent DNA polymerase (New England Biolabs,Ipswich, MA, USA), a sense primer (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing ... pro-tein is made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1Structure of Salmonella typhimurium SurE A. Pappachan et al.5856 FEBS Journal 275 ... S, Khachatr-yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotogamaritima stationary phase survival protein SurE: a novel acid phosphatase. Structure...
  • 10
  • 553
  • 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCGCAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCTCGAATTCG GATCCGGTACCTCAGAAGGTAGACAGCAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cyssequence was introduced at the C-terminus ... puri-fied, and annealed. The Not1 site in the resulting genewas removed using the complementary oligomers5¢-GGCGGGAGGGGCGATAATTTTATCGCGTTAAAACCG-3¢ (forward) and 5¢-CGGTTTTAACGCGATAAAATTATCGCCCCTCCCGCC-3¢ ... an N-terminal Nco1 cloning site.The forward o ligomer 5 ¢-TCCGAAACCAGCG GCCGCTTTATCGCGTTA AAAC CGGT GATCAA ACCCC -3¢ and thereverse oligomer 5¢-GTAGGCCTT TGAATTCCTCAAAAAGTGCGGCTCGAT-3¢ were...
  • 10
  • 647
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Models and Training for Unsupervised Preposition Sense Disambiguation" pptx

... corpus was chosen as a startingpoint for our study since it allows a comparison withthe original SemEval task. We plan to use largeramounts of additional training data.We used an in- house ... LinguisticsModels and Training for Unsupervised Preposition Sense DisambiguationDirk Hovy and Ashish Vaswani and Stephen Tratz and David Chiang and Eduard HovyInformation Sciences InstituteUniversity ... parameters being estimated.As a starting point, we choose the standard first-order Hidden Markov Model as depicted in Figure 1a. Since we train a separate model for each preposi-tion, we can...
  • 6
  • 436
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Structural and Topical Dimensions in Multi-Task Patent Translation" ppt

... onComputational Linguistics (COLING’10), Beijing,China.Alexandru Ceaus¸u, John Tinsley, Jian Zhang, and Andy Way. 2011. Experiments on domain adap-tation for patent machine translation in the ... Ueffing, Gholamreza Haffari, and AnoopSarkar. 2007. Transductive learning for statisticalmachine translation. In Proceedings of the 45th An-nual Meeting of the Association of ComputationalLinguistics ... learning has mostly been discussed un-der the name of multi-domain adaptation in thearea of statistical machine translation (SMT). Ifwe consider domains as tasks, domain adapta-tion is a special...
  • 11
  • 436
  • 0
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

... Cryphonectria parasitica [9] and in the biosynthesis of cinnabarinic acid, a fungal metaboliteproduced by Pycnoporus cinnabarinus that exhibits anti-microbial activity against various bacterial species ... °Cfor20s,52°Cfor20s and 70 °C for 2 min; then a final extension at 72 °Cfor 10 min. The primers for lac1 PLAC1F(5¢-AGCTTTCATTCCCAGTGATTG-3¢)andPLAC1R(5¢-AACGAGCTCAAGTACAAATGACT-3¢) were designed accordingto ... 686–691.49. Kaviyarasan, V. & Natarajan, K. (1997) Changes in extracellularenzyme activities during growth and fruiting of Pleurotus cornu-copiae var. citrinopileatus.InAdvances in Mushroom...
  • 11
  • 703
  • 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

... target).Zebrafish maintenance and preparation of eggsTAB zebrafish were reared and maintained on a light ⁄ darkcycle essentially as described by Westerfield [49]. All experi-ments and fish maintenance ... JQ & Martindale MQ (1996) Dualorigins of mesoderm in a basal spiralian: cell lineageanalyses in the polyclad turbellarian Hoploplana inqui-lina. Dev Biol 179, 329–338.48 Lambert JD & ... transmembrane domain and theserine ⁄ threonine kinase domain. A. Herpin et al. BMP/activin pathway in Crassostrea gigasFEBS Journal 272 (2005) 3424–3440 ª 2005 FEBS 3427Daf-1 C. elegansCrassostrea...
  • 17
  • 508
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP