0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Alternative substrates for wild-type and L109A E coli CTP synthases Kinetic evidence for a constricted ammonia tunnel doc

Báo cáo khoa học: Alternative substrates for wild-type and L109A E. coli CTP synthases Kinetic evidence for a constricted ammonia tunnel doc

Báo cáo khoa học: Alternative substrates for wild-type and L109A E. coli CTP synthases Kinetic evidence for a constricted ammonia tunnel doc

... Alternative substrates for wild-type and L10 9A E. coli CTP synthases Kinetic evidence for a constricted ammonia tunnel Faylene A. Lunn and Stephen L. BearneDepartment of Biochemistry and ... weredetermined in triplicate and average values are reported.The reported errors are standard deviations. Initial rate kinetic data was fit to Eqn (1) by nonlinear regressionanalysis using the ... detailed kinetic characterization of the ability of E. coli CTPS to utilize alternative substrates. We show that replacement of Leu109by alanine in E. coli CTPS causes the enzyme to discrim-inate...
  • 9
  • 404
  • 0
Báo cáo khoa học: Effects of the G376E and G157D mutations on the stability of yeast enolase – a model for human muscle enolase deficiency pdf

Báo cáo khoa học: Effects of the G376E and G157D mutations on the stability of yeast enolase – a model for human muscle enolase deficiency pdf

... the 15 residues are con-served. In view of the structural similarities betweenyeast and mammalian enolases and the high degree ofsequence conservation, we believe that the effects ofthese ... dissociated. The identification of the cleavage sites and spectral studies of enolase have revealed some of the structural differ-ences between the dimeric and monomeric forms of this enzyme.AbbreviationsAUC, ... or elastase (data not shown).The cleaved samples were analysed by quadrupoletime-of-flight (Q-TOF) MS and the cleavage sites wereidentified (Table 2). At 15 °C, there was no cleavage ofthe wild-type...
  • 10
  • 520
  • 0
Báo cáo khoa học: The association of heavy and light chain variable domains in antibodies: implications for antigen specificity pot

Báo cáo khoa học: The association of heavy and light chain variable domains in antibodies: implications for antigen specificity pot

... therefore has an effect on the overall conformationof the binding site. In this article, we analyze the structure of the interfacebetween the heavy and light chain variable domains and show that ... hapten-like antigens from peptide and protein antigens.In summary, the results of the analysis describedhere clearly indicate that there are at least two differ-ent packing modes for the association ... Hubert,unpublished results) was selected as the best performingtechnique on the basis of the corresponding silhouettevalue [31] (see Materials and methods section for details), and produced three clusters...
  • 9
  • 387
  • 0
Báo cáo khoa học: Role of glutaredoxin 2 and cytosolic thioredoxins in cysteinyl-based redox modification of the 20S proteasome docx

Báo cáo khoa học: Role of glutaredoxin 2 and cytosolic thioredoxins in cysteinyl-based redox modification of the 20S proteasome docx

... Costa V (2000) Adaptiveresponse of the yeast Saccharomyces cerevisiae to reac-tive oxygen species: defences, damage and death. RedoxRep 5, 277–285.25 Maris AF, Assumpcao AL, Bonatto D, Brendel ... solvent-accessible. All of the other cysteine residues are eitherburied in the skeletal structure or exposed to the inter-nal catalytic chamber environment. Therefore, weinvestigated whether ... Degradationby the proteasome was determined by the decreasedintensity of Grx2 bands as evaluated by measurementof optical density. When incubated in standard buffer,n-PT was able to degrade...
  • 14
  • 364
  • 0
Báo cáo khoa học: Lid L11 of the glutamine amidotransferase domain of CTP synthase mediates allosteric GTP activation of glutaminase activity docx

Báo cáo khoa học: Lid L11 of the glutamine amidotransferase domain of CTP synthase mediates allosteric GTP activation of glutaminase activity docx

... whereasthe G36 0A enzyme was about twofold more active than wild-type enzyme.The elevated K A for GTP and reduced GTP activation of CTP synthesis ofthe mutant enzymes are in agreement with a ... (Table 1) reflects the amino acid replacement and not an artefact due to the presence of denaturedprotein. Kinetic constants of the glutaminase half-reactionExcept the R359P and G360P enzymes, ... of ammonia from the GATasedomain to the synthase domain [14].Experimental proceduresSite-directed mutagenesis and DNA sequencingSite-directed mutagenesis of the L. lactis pyrG gene wasperformed...
  • 9
  • 222
  • 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... trans-acting factor for theESE3 sequence [25] and presumably also for the ESEsequence upstream of D4 [42]. It has been reportedthat ESE3 and ESS3 regulate the efficiency of A7 utili-zation by modulating ... the tat intron is regulated by the combi-nation of the above ESS elements, with ESE elementslocated in the third tat exon [25] as well as a purinerich ESE sequence (ESE2) located upstream ... positively as well asnegatively, by these cis-acting splicing regulatorysequences (splicing enhancers and silencers). Several cis-acting elements, i .e. splicing silencer elements, havebeen identified...
  • 10
  • 434
  • 0
Báo cáo khoa học: Alternative splicing produces an H-protein with better substrate properties for the P-protein of glycine decarboxylase doc

Báo cáo khoa học: Alternative splicing produces an H-protein with better substrate properties for the P-protein of glycine decarboxylase doc

... P-protein. It was further substantiated byanalysis of an engineered alternative ArabidopsisH-protein. Hence, several lines of independent experi-mental evidence consistently demonstrated that alternative ... kinetic parameters were calculated by nonlin-ear regression analysis using the software packagegraphpad prism (GraphPad Software, San Diego, CA,USA). All kinetic data are means ± SD from three or ... vivo.Results and DiscussionThe two alternative H-proteins from the C4plantFlaveria trinervia, FtGLDH and FtGLDHAA, wereoverexpressed in Escherichia coli and obtained asapparently pure recombinant...
  • 7
  • 394
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Alternative Approaches for Generating Bodies of Grammar Rules" docx

... the sizes of theautomata. The differences between MDI-based and bigram-based automata are not as dramatic as inthe “One-Automaton” case (Table 1), but the formeragain have consistently lower ... “Many-Automata” case (where we learned two automata for each POS) we used the same procedure as for the “One-Automaton” case, but now for ev-ery individual POS. Because of space constraintswe are ... For eachresulting dependency tree we extract a sample set ofright and left sequences of dependents as shown inFigure 2. From the tree we generate a sample setwith all right sequences of dependents...
  • 8
  • 285
  • 0
Tài liệu Báo cáo khoa học: Interruption of triacylglycerol synthesis in the endoplasmic reticulum is the initiating event for saturated fatty acid-induced lipotoxicity in liver cells pdf

Tài liệu Báo cáo khoa học: Interruption of triacylglycerol synthesis in the endoplasmic reticulum is the initiating event for saturated fatty acid-induced lipotoxicity in liver cells pdf

... initiation factor 2a (eIF 2a) wasapparent after 16 h of stearate treatment, reached a peak at 22 h, and declined thereafter. Concomitantlywith eIF 2a phosphorylation, dramatic elevations in theexpression ... was efficient in oleate-treated cells,whereas stearate-treated cells contained fewer and smaller lipid droplets after 24 h of treatment (Fig. 5A) .Moreover, coadministration of oleate restored ... elusive, and the key ele-ments that determine the induction of toxicity have notbeen identified yet.The aim of the present investigation was to perform a detailed evaluation of several aspects...
  • 12
  • 721
  • 0
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGCSGA1_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTTSGA1_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTCTACAAACTCTGTAAAACTTATH1_suc2 ... sequenceF2_ATH1 ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAAR1_ATH1 ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAACATH1_pUG36_D GCACTAGTATGAAAAGAATAAGATCGCTTTATH1_pUG36_R ... GGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTACATGGGTTTTTTCTCCTTGACGR1_pLC1 TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAACPEP4_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGTTCAGCTTGAAAGCPEP4_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGCSGA1_D...
  • 15
  • 475
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP