Báo cáo khóa học: Modiﬁed colorimetric assay for uricase activity and a screen for mutant Bacillus subtilis uricase genes following StEP mutagenesis pptx

... Modified colorimetric assay for uricase activity and a screen for mutant Bacillus subtilis uricase genes following StEP mutagenesis Su-Hua Huang and Tung-Kung WuDepartment of Biological Science ... mutants, designated B4 and B8, had uricase activity. Analyzing the motif sequence of mutant uricase Two active variants (B4 and B8) were analyzed by sequenceanalysis and found to have identical nucleotide ... preparation of crude cellular extracts and affinitychromatography of purification and an activity assay byspectrophotometry. We have demonstrated the usefulnessof this assay and used it to screen...

Tài liệu Báo cáo khoa học: "Modiﬁed Distortion Matrices for Phrase-Based Statistical Machine Translation" doc

... is a hierarchical phrase orientationmodel (Tillmann, 2004; Koehn et al., 2005; Galley and Manning, 2008) trained on all the available par-allel data. We choose the hierarchical variant, as ... SSST, NAACL-HLT 2007/ AMTA Workshop on Syntax and Structure in StatisticalTranslation, pages 1–8, Rochester, New York, April.Association for Computational Linguistics.Andreas Zollmann, Ashish ... Proceedings of the ACL Workshop on In-trinsic and Extrinsic Evaluation Measures for MachineTranslation and/ or Summarization, pages 57–64, AnnArbor, Michigan, June. Association for ComputationalLinguistics.Helmut...

Báo cáo khoa học: Modiﬁed PCR methods for 3¢ end ampliﬁcation from serial analysis of gene expression (SAGE) tags doc

... oligo (dT)NVTTTTTTTNBAAAAAAANVTTTTTTTNBAAAAAAANVTTTTTTTNBAAAAAAANVTTTTTTTNBAAAAAAANVTTTTTTT16161616161616165′5′5′-cap oligoNVTTTTTTTNVTTTTTTTNBAAAAAAANVTTTTTTTGGGCCCGGGCCCGGGCCCGGGCCCGGGCCCAnneal ... et al. Methods for 3¢ end ampliﬁcation from SAGE tagsFEBS Journal 276 (2009) 2657–2668 ª 2009 The Authors Journal compilation ª 2009 FEBS 2659mRNAmRNANBAAAAAAA-3′NBAAAAAAA-3′NBAAAAAAAModified ... primer:5¢-CCAGACACTATGCTCATACGACGCAG(T)16VN-3¢, where N = A, C, G or T, and V = A, G or C.5¢-cap oligonucleotide primer: 5¢-AAGCAGTGGTATCAACGCAGAGTACGCGGG-3¢PLF: 5¢-AAGCAGTGGTATCAACGCAGAGT-3¢PLR: 5¢-CCAGACACTATGCTCATACGACG-3¢Tag-speciﬁc...

Báo cáo khoa học: Modiﬁed merozoite surface protein-1 peptides with short alpha helical regions are associated with inducing protection against malaria docx

... immunological analysis on days 0 and 15, and 20 days after each immunization.Challenge and parasitemia assessmentBoth immunized and control A. nancymaae monkeys wereinfected with 200 000 P. falciparum ... 5%acetic acid (Merck), and then analysed and puriﬁed by RP-HPLC on an analytical Vydac C-18 column and a Vydacpreparative C-18 column by linear-gradient elution from 0 to100% B with the following ... invasion process of the Plasmodium falciparummalaria parasite [1–3], allowing the entry and survival of thisdeadly parasite. More than 250 million people are infectedwith P. falciparum annually,...

Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf

... (Kurohashi and Na-gao, 1994) or CaboCha (Kudo and Matsumoto,2002). Although this information is less accu-rate than manually annotated information, theseautomatic analyzers provide a large amount ... data (different from the trainingdata)1.RerankingCandidate 1Candidate 2Candidate 3Candidate 4: Case element: VerbCandidateCandidateFigure 2: Selection of possible parses for rerankingMany ... Co-occurrence Information and a Combination of Case ElementsTakeshi AbekawaGraduate School of EducationUniversity of Tokyoabekawa@p.u-tokyo.ac.jpManabu OkumuraPrecision and Intelligence LaboratoryTokyo...

Tài liệu Báo cáo khoa học: "Know When to Hold''''Em: Shuffling Deterministically in a Parser for Non concatenative Grammars*" pdf

... Bach's (1979) wrapping operations, Pollard's (1984) head-wrapping operations, and Moortgat's (1996) extraction and infixation operations in (categorial) type-logical grammar. ... efficient than a bidirectional or non-directional approach. Lastly, the grammar is head-driven, and we would thus expect the most appropriate parsing algorithm to take advantage of the information ... type-logical grammar. What is common to the proposals of Dowty, Reape, and Kathol, and to the particular analysis implemented here, is the characterization of nat- ural language syntax in terms...

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... 32]ISS hnRNP A1 UAGUGAAUAGAGUUAGGCAGGGA 7928–7950ESE3 ASF ⁄ SF2 GAAGAAGAA 8016–8025hnRNP A1 UAGAAGAAGAA 8018–8025HIV-1 alternative splicing regulation J. Tazi et al.872 FEBS Journal 277 (2010) ... 5428–5437ESE2 SC35, SRp40 CCAGUAGAUCCUAGACUAGA 5418–5437 A5 ESE GAR ASF ⁄ SF2, SRp40 GAAGAAGCGGAGACAGCGACGAAGA 5558–5582 [7] A7 ESS3 hnRNP A1 ,hnRNP E1 ⁄ E2AGAUCCAUUCGAUUAGunknown8047–8062 [43, ... viral and cellular proliferation by mediat-ing long terminal repeat activation, cell cycle arrest atthe G2 phase and apoptosis. It is also involved innuclear localization [31,32] and regulation...

Báo cáo khoa học: "Adaptivity in Question Answering with User Modelling and a Dialogue Interface" pptx

... wrote many books for kids and adults,including: “The Witches”, “Charlie and the Chocolate Fac-tory”, and “James and the Giant Peach".2http://www.cs.york.ac.uk/aig/aqua4 Question Answering ... controversial answers. Weintroduce adaptivity in QA and IR by cre-ating a hybrid system based on a dialogueinterface and a user model. Keywords:question answering, information retrieval,user ... a collection ofmemorized traditional verses and phases?”— U Mmed: “No reliable ancient evidence for Homer –[. . . ] General ancient assumption that same poet wrote Il-iad and Odyssey (and...

Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc

... tracheobronchi-al tree, nasal mucosa and sweat glands [25]. Humantear lipocalin has signiﬁcant sequence homology withthe human forms of OBP and, at least in humans, par-tially shares a similar tissue ... inthe aqueous matrix of biological ﬂuids. Therefore, a protein scavenger that could trap, and eventually deli-ver, 4-hydroxyalkenals to appropriate degradativepathways, might aid other inactivating ... MontagueDC, Ceci JD, Yang Y, Awasthi S, Awasthi YC & Zim-niak P (2004) Physiological role of mGSTA4-4, a glu-tathione S-transferase metabolizing 4-hydroxynonenal:generation and analysis...

Tài liệu Báo cáo khoa học: Simpliﬁed yet highly accurate enzyme kinetics for cases of low substrate concentrations ppt

... the singlestate variable x parameterizing these SIMs, as well asthe eight state variables constitutingy that reach a partial equilibrium on a fast timescale and are used toformulate the ZDP ... associated with it, and report numer-ical data related to the dimensionality and the choice ofparameterizing variable x for the ZDP manifolds.The PTS is a mixed signal transduction and transportpathway ... condition for all scaled variables was set to 0.5 (one-half of the steady state, interms of the unscaled variables zi) and all time trajectories approach zero (as the unscaled variables tend...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ