0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Local binding with globally distributed changes in a small protease inhibitor upon enzyme binding ppt

Báo cáo khoa học: Local binding with globally distributed changes in a small protease inhibitor upon enzyme binding ppt

Báo cáo khoa học: Local binding with globally distributed changes in a small protease inhibitor upon enzyme binding ppt

... The Authors Journal compilation ª 2006 FEBS Local binding with globally distributed changes in a small protease inhibitor upon enzyme binding Zolta´nGa´spa´ri1, Borba´la Szenthe2, Andra´s ... discrep-ancy may be, at least in part, due to the insufficientsampling of relaxation parameters as data is available A BDCFig. 3. (A, B) Chemical shift changes in SGCI upon complexation. Changes are ... spectroscopy.1H–15Ncorrelation (HSQC) spectra of the inhibitor with increasing amounts of the enzyme reveal tight and specific binding in agreement with biochemicaldata. Unexpectedly, and unparalleled among canonical...
  • 12
  • 396
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Sequential Labeling with Latent Variables: An Exact Inference Algorithm and Its Efficient Approximation" ppt

... of a training data. The sec-ond term is a regularizer that is used for reducingoverfitting in parameter estimation.3 Latent-Dynamic InferenceOn latent conditional models, marginalizing la-tent ... latent variables are advantageous in learning (Matsuzaki et al., 2005; Petrov andKlein, 2007; Blunsom et al., 2008). Actu-ally, discriminative probabilistic latent variablemodels (DPLVMs) have ... models can be seen as a naturalextension of CRF models, and CRF models canbe seen as a special case of DPLVMs that employonly one latent variable for each label.To make the training and inference...
  • 9
  • 284
  • 0
Tài liệu Báo cáo khoa học: Molecular defect of isovaleryl-CoA dehydrogenase in the skunk mutant of silkworm, Bombyx mori ppt

Tài liệu Báo cáo khoa học: Molecular defect of isovaleryl-CoA dehydrogenase in the skunk mutant of silkworm, Bombyx mori ppt

... biochem-ical data, along with previous observations that thesku mutant accumulates isovaleric acid and branched-chain amino acids, strongly indicate that a singleamino acid substitution (G376V) in ... most intriguing features of the sku mutantis that the mature larva accumulates branched-chainamino a cids, leucine, isoleucine and valine, in haemolymphat levels  4 times higher in females and ... isoleucine and valine also accumulate to the samedegree as leucine [6]. This phenomenon suggeststhat leucine catabolism plays an important role in regu-lating all three branched-chain amino acid...
  • 12
  • 631
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System" pdf

... semantic analysis, and pragmatic analysis. Each stage has been designed to use linguistic data such as the lexicon and grammar, which are maintained separately from the engine, and can easily ... resources into our natural language understanding system. Client- server architecture was used to make a large volume of lexical information and a large knowledge base available to the system at ... Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System Lewis M. Norton, Deborah A. Dahl, Li Li, and Katharine P. Beals Unisys Corporation 2476...
  • 5
  • 416
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Paraphrasing Using Given and New Information in a Question-Answer System" docx

... and new information in formulating a paraphrase that differs in a meaningful way from the user's question. A description is also given of the transformational grammar used by the paraphraser ... represent information assumed by the questioner to be true of the database domain. This lapeling of information within the question will allow the construction of a natural paraphrase, avoiding ambiquity. ... This example, as well as all sample questions and paraphrases that follow, were, =aken from actual sessions with the paraphraser. Question (A) mad its possible paraphcases (B) and (C) are the...
  • 6
  • 532
  • 0
Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc

Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc

... pre-pro-tyrosinase (Fig. S1) can be dividedapproximately into three domains: a twin argininetranslocase (TAT) signal peptide, a core domain con-taining the two copper -binding motifs and a C-termi-nal ... constructs without thepredicted N-terminal signal peptide (amino acids1–36), we retained amino acid 36, an alanine, ratherthan using amino acid 37, a lysine, because it isknown that, after a post-translational ... motifArg40Cys84Tyr349Tyr347Copper binding motifTrypsinisedpro-tyrosinase 332 amino acidsCore domain 36–370Copper binding motifArg40Cys84Tyr349Tyr347Lys370Ala36Ala36Ala36Val357Phe518BLaccaseTyrosinaseβ-sheet...
  • 13
  • 778
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Learning to Win by Reading Manuals in a Monte-Carlo Framework" pot

... terrain.S S AA AA ASWhen the settlers becomes active, chose build road. A AS SS A Use settlers or engineers to improve a terrain square within the city radius A A A SA SSSSS✘✘Phalanxes are ... built -in AI.7 ResultsGame performance As shown in Table 1, our lan-guage aware Monte-Carlo algorithm substantiallyoutperforms several baselines – on average winning53.7% of all games within ... Balla and A. Fern. 2009. UCT for tactical assaultplanning in real-time strategy games. In 21st Interna-tional Joint Conference on Artificial Intelligence.Darse Billings, Lourdes Pe˜na Castillo,...
  • 10
  • 508
  • 0
Báo cáo khoa học: Cold exposure and associated metabolic changes in adult tropical beetles exposed to fluctuating thermal regimes ppt

Báo cáo khoa học: Cold exposure and associated metabolic changes in adult tropical beetles exposed to fluctuating thermal regimes ppt

... with 6-aminoquinolyl-N-hydroxysuccinimidylcarbamate (using a Waters Accq-Tag amino acid analysis system; Waters Cor-poration, Milford, MA, USA) and reversed-phase liquidchromatographic separation (see [25] for a full ... ultrapure water.Free amino acids were assayed as described by Bouche-reau et al. [25]. Amino acids were characterized and quanti-fied by HPLC after precolumn derivatization with 6-aminoquinolyl-N-hydroxysuccinimidylcarbamate ... Tyr playsan important role in that process, as a precursor ofseveral stress hormones in insects (including DA, OAand tyramine [15,20]). It was demonstrated in Drosophila species that heat exposures...
  • 9
  • 376
  • 0
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

... AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC6F-XHO AATTCTCGAGTGCTGCTGCTGCGAATGCTGCC3K -A7 K GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAGHC-K 7A GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAGMG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCCMG3K6S7K ... (5¢fi3¢)MA(9)ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCCMGA(8) ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCCMG6S GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCCMG6X ... GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCCMG3K6S7K GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCCT3 AATTAACCCTCACTAAAGGGB1 GCCGGGATCCTAGGGCGAATTGGGTACC864 T. Utsumi et al. (Eur. J. Biochem....
  • 12
  • 512
  • 0
Báo cáo khoa học: Identification and localization of glycine in the inner core lipopolysaccharide of Neisseria meningitidis ppt

Báo cáo khoa học: Identification and localization of glycine in the inner core lipopolysaccharide of Neisseria meningitidis ppt

... remains unclear, butone could expect that in a particular niche this structure mayconfer an advantage upon the bacterium, thus aiding itscompetitiveness in maintaining an infection.ACKNOWLEDGEMENTSWe ... structural analyseson meningococcal core oligosaccharides had been per-formed following O-deacylation and/or dephosphorylation.Naturally, base-labile residues that may have been present in the native ... L3galE oligosaccharide and BZ157 B5+ galE oligosaccharide,and MS data for other strains that elaborate glycine wouldsuggest that in meningococcal LPS the glycine moiety isconsistently located...
  • 7
  • 449
  • 1

Xem thêm

Từ khóa: Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ