Báo cáo khoa học: Effect of magnesium ions on the activity of the cytosolic NADH/cytochrome c electron transport system pptx
Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx
... skeletal muscle. Table 1 shows the effect of temperature on activation coefficient (Ka) values forallosteric activators and the values of concentration of the inhibitor that reduces control activity ... elicit an activation of PFK activity at 5 C; in fact, the addition of inorganic phos-phate resulted in an inhibition of PFK activity. Fur-ther analysis of phosphate effects on PFK at 5 C seemed ... 2.2-fold.Phosphate effects on ATP kinetics at 5 C were differ-ent. Phosphate had virtually no affect on the Km of Fig. 1. Effects of pH and inorganic phosphate concentration on the activity of S. lateralis...
- 9
- 579
- 0
Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt
... GTTGAGATCTGTTGTTTACTTCTTC 423MIH-LF GAGTTATCAACGACGAGTGTCCMIH-LR GAGACGACAAGGCTCAGTCC 249AK-LF AAAGGTTTCCTCCACCCTGTAK-LR ACTTCCTCGAGCTTGTCACG 450CHH-SF GACTTGGAGCACGTGTGTCHH-SR TATTGGTCAAACTCGTCCAT ... if the actions of the CHH neuropeptides on repression of ecdysteroid synthesisby the Y-organ (YO) are considered. The most widely accepted paradigm of moult controlin crustaceans concerns the ... TATTGGTCAAACTCGTCCAT 143MIH-SF AAGACAGGAATGGCGAGTMIH-SR AATCTCTCAGCTCTTCGGGAC 100AK-SF AAACGGTCACCCTCCTTGAAK-SR ACTTCCTCGAGCTTGTCACG 1323282 J. S. Chung and S. G. Webster (Eur. J. Biochem. 270)...
- 9
- 587
- 0
Tài liệu Báo cáo khoa học: "Semantic Information and Derivation Rules for Robust Dialogue Act Detection in a Spoken Dialogue System" pptx
... Detection accuracies of cascading componentsfor the lexical score.value of λL0.5 0.6 0.7 0.8Accuracy (%) 84.3 84.6 85.1 84.9Table 4: Evaluation on different weighted product fusion the ... connection in Figure 2).4 The Lexical Score Function The main challenge of this system is the computa-tion of the lexical score g(A, W). In this paper, wepropose a novel data-driven scheme incorporatingmany ... Incremental EvaluationWe incrementally add techniques in our SDS un-til the complete proposed overall system is imple-mented, to observe the effect of these techniques. The detection accuracies...
- 6
- 555
- 0
Báo cáo khoa học: Effect of magnesium ions on the activity of the cytosolic NADH/cytochrome c electron transport system pptx
... the correct execu-tion of the apoptotic programme and/or the activation of the NADH/cyto -c electron transport pathway.Abbreviationscyto-b5, cytochrome b5; cyto -c, cytochrome c; FCCP, carbonyl ... the oxidation rate of exogenous ferrocyto -c arecorrelated with the frequency of speci c contact sites.With regard to the effect of magnesium on the activ-ity of the cytosolic NADH/cyto -c electron ... juxtaposed to the cytochrome oxidase molecules spanning MIM. All of these components are required for the correct exe-cution of the cytosolic NADH/cyto -c system. The activity of this electron transport...
- 12
- 441
- 0
Báo cáo khoa học: " Effect of the medical emergency team on long-term mortality following major surgery"
... to the nearest level 1 trauma center of the region, the Cologne-Merheim Medical Center (CMMC). Rapid communication on different aspects associated with the long-distance air trans-fer, characteristic ... tertiary medical care provided to this uniquecohort of patients, in particular with respect to complex woundmanagement, infection and psychoemotional control. Accord-ing to the concept of a trimodal ... acquired mucormycosis from contamination of hiswounds at the time of trauma or during first aid measures.Mucormycosis is caused by the Mucor mould species, whichis a very common mould species...
- 9
- 761
- 0
Báo cáo khoa học: "Effect of intern’s consecutive work hours on safety, medical education and professionalism"
... http://ccforum.com/content/9/2/E3529Available online http://ccforum.com/content/9/5/528We agree with the recommendation that further researchshould study the effects of sleep deprivation and workschedule ... failures after they had been working formore than 16 hours on the traditional schedule [2].Letter Effect of intern’s consecutive work hours on safety, medicaleducation and professionalismChristopher ... 2005 Critical Care 2005, 9:528-530 (DOI 10.1186/cc3730)This article is online at http://ccforum.com/content/9/5/528© 2005 BioMed Central LtdSee related Journal club critique, http://ccforum.com/content/9/2/E3529Available...
- 3
- 514
- 0
Tài liệu Báo cáo khoa học: Effect of siRNA terminal mismatches on TRBP and Dicer binding and silencing efficacy pdf
... silenc-ing capacity as in the presence of TRBP, actuallybecoming the most active of all the siRNAs under theseconditions (Fig. 2A). In contrast, after knockdown of Dicer, only the silencing ... function of TRBP in RNAi.Here, we have characterized the interactions of siRNAs that contain terminal mismatches with TRBPand Dicer, and determined the impact of these interac-tions on their ... the differences among the siRNAs that we observed at 10 nm were within the dose-responsive concentration range (Fig. S1). Effect of TRBP or Dicer knockdown on the silencing efficacy of mismatched...
- 10
- 700
- 0
Tài liệu Báo cáo khoa học: Effect of ionic strength and oxidation on the P-loop conformation of the protein tyrosine phosphatase-like phytase, PhyAsr docx
... structural consequences of the P-loop transition that occurs upon oxidation, the program contact [17] was used to compare all the contacts made with the catalytic cysteine or cysteinesulfonic acid ... six contacts that aremade directly with the cysteine S c in the unoxidizedconformation. Oxidation of the catalytic cysteinedecreased the contacts made to the cysteine S c butresulted in the ... result of oxidation of the cysteine.R258OCS 252AR258OCS252BFig. 2. (A) The P-loop is observed in the catalytically inactive, openconformation upon oxidation of the catalytic cysteine. The electron density...
- 10
- 596
- 0
Tài liệu Báo cáo khoa học: Effect of deletion of the DNase I hypersensitive sites on the transcription of chicken Ig-b gene and on the maintenance of active chromatin state in the Ig-b locus docx
... member of the OCT family transcription factors appeared to beinvolved in the transactivation of the region which had the highest enhancing activity of the three DHSs. The state of acetylation in ... DHSs on the transcription of Ig-b gene and on the mainten-ance of the active chromatin state.ResultsGeneration of DT40/Cre cells with a long deletionin one allele of the Ig-b locusTo genetically ... sequence is essential for the estab-lishment and maintenance of acetylation in the GHlocus. Because deletion of this region has no effect on the formation of cell type-speci c DHSs, the regionrequired...
- 11
- 638
- 0
Tài liệu Báo cáo khoa học: Effect of gadolinium on the ryanodine receptor/ sarcoplasmic reticulum calcium release channel of skeletal muscle docx
... side of the channel and does not penetrateto the cis side. The effect of changing cis calcium con-centration on the inhibitory effect of cis gadoliniumwas also investigated. When calcium concentration ... activation of the channel at100–250 lm and inactivation at higher luminal calciumconcentrations [15,16]. As the effect of the luminal cal-cium concentration was voltage-dependent and the acti-vation ... acti-vation depended on the cis EGTA concentration in bothcases the authors concluded that calcium ions regulate the channel activity by binding to cytosolic Ca-bindingsites after flowing through the...
- 8
- 587
- 1
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ