0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: NtKTI1, a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response pot

Báo cáo khoa học: NtKTI1, a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response pot

Báo cáo khoa học: NtKTI1, a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response pot

... a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response Hao Huang*, Sheng-Dong Qi*, Fang Qi, Chang-Ai Wu, Guo-Dong Yang ... that NtKTI1 exertedprominent antifungal activity towards R. solani and moderate antifungal activity against Rhizopus nigricans and Phytophthora parasitica var. nicoti-anae. Bioassays of transgenic ... treatment. In vitro antimicrobial assayand in planta studies demonstrated that NtKTI1 is an antifungal protein that increases the resistance oftobacco to fungal attack.ResultsIsolation and...
  • 13
  • 501
  • 0
Báo cáo khoa học: GHP, a new c-type green heme protein from Halochromatium salexigens and other proteobacteria potx

Báo cáo khoa học: GHP, a new c-type green heme protein from Halochromatium salexigens and other proteobacteria potx

... purified apoprotein with trypsin (T) and Asp-N endo-proteinase (D), and of native protein with Glu-C endoproteinase (S). Amino acids identified by Edman degradation and MS tandem fragmen-tation are ... translation [28]. The GTPase has an OB domain at the N-terminus and a zinc-fingerdomain at the C-terminus which are involved in bind-ing. PCD is known to have two roles, as an enzymeand as a regulator. ... indicates a mass of 11 kDa.Amino-acid sequence of GHP and molecularmassThe complete amino-acid sequence (Fig. 2) of GHPwas determined by a combination of automatedEdman degradation and tandem...
  • 11
  • 517
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Combining a Statistical Language Model with Logistic Regression to Predict the Lexical and Syntactic Difficulty of Texts for FFL" potx

... Belgiumthomas.francois@uclouvain.beAbstractReading is known to be an essential task in language learning, but finding the ap-propriate text for every learner is far from easy. In this context, automatic ... lexical and syntacticvariablesAny text classification tasks require an object(here a text) to be parameterised into variables,whether qualitative or quantitative. These inde-pendent variables ... consideredas a nominal, ordinal, or interval variable, eachlevel of measurement being linked to a particu-lar regression technique: multiple linear regres-sion for interval data; a popular cumulative...
  • 9
  • 514
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Guiding a Constraint Dependency Parser with Supertags" pot

... shown in Ta-ble 4. As expected, making supertag constraintshard (with a value of 0.0) over-constrains mostparsing problems, so that hardly any analyses canbe computed. Other values near 0 avoid ... obtain and evaluate supertag predictions, weused the NEGRA and TIGER corpora (Brants etal., 1997; Brants et al., 2002), automatically trans-formed into dependency format with the freelyavailable ... more important to the grammar.Since constraints can be soft as well as hard, pars-ing in the WCDG formalism amounts to multi-dimensional optimization. Of two possible analy-ses of an utterance,...
  • 8
  • 276
  • 0
Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc

Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc

... Thesereceptors share common features: all contain seventransmembrane spanning domains and are coupled toG-proteins themselves anchored to the inner leaflet ofthe plasma membrane. In contrast ANP-induced ... is a significant increase in food intake, caused by the lackof a satiety signalling, whereas no change in foodintake was detected in the B [a] P-treated animals. In addition, the absolute values ... ofB [a] P on ANP receptor signalling might result from the fact that, unlike b-adrenergic and ACTH receptorsthat contain seven transmembrane spanning domains,the ANP receptor (NPR -A) is a guanyl...
  • 11
  • 424
  • 0
Báo cáo khoa học: Swollenin, a Trichoderma reesei protein with sequence similarity to the plant expansins, exhibits disruption activity on cellulosic materials pptx

Báo cáo khoa học: Swollenin, a Trichoderma reesei protein with sequence similarity to the plant expansins, exhibits disruption activity on cellulosic materials pptx

... to the insolublesubstrate. In addition to plants, a protein with an endoglucanasedomain and a domain with sequence similarity to expansinshas been reported in the plant pathogen Clavibactermichiganensis ... activities against HEC (Fluka) and barleyb-glucan (Biocon) were determined according to IUPAC[26] and against birch xylan (Roth) as presented [27].Mannanase activity was assayed according to the ... have an N-terminal signal sequence followed by a cellulose bindingdomain. A major part of the remaining sequence was foundto have sequence similarity with plant expansins in a BLAST database...
  • 10
  • 402
  • 0
Tài liệu Báo cáo khoa học: Time-dependent regulation analysis dissects shifts between metabolic and gene-expression regulation during nitrogen starvation in baker’s yeast doc

Tài liệu Báo cáo khoa học: Time-dependent regulation analysis dissects shifts between metabolic and gene-expression regulation during nitrogen starvation in baker’s yeast doc

... glycolysis and may therefore provide an additionallayer of regulation.Second, specificity of protein degradation is also a plausible mechanism to explain our data. In general,not all proteins are ... mL. In thisand earlier studies the fermentative capacity is measured asthe rate of ethanol production in an off-line assay in whichcells are transferred to a complete growth medium underanaerobic ... NucSys, ECMOAN, and UniCellSys.The CEN.PK113-7D strain was kindly donated byPKo¨tter, Euroscarf, Frankfurt.References1 Daran-Lapujade P, Jansen ML, Daran JM, van GulikW, de Winde JH & Pronk...
  • 16
  • 654
  • 0
Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx

Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx

... Katayama H, Tominaga S, Takasuka T,Nakatsuji T, Sonobe T, Aida K & Nagasawa H (2005)Cloning and characterization of a molt-inhibitinghormone-like peptide from the prawn Marsupenaeusjaponicus. ... Province,Thailand).Experiments involving animals were carried out in accor-dance with animal care and use protocol of the MahidolUniversity Animal Care and Use Committee (MUACUC).Total RNA preparation and first-strand ... (5¢-TAATACGACTCACTATAGGGAGAAA CATC CTGG ACAGCA AATGC AGGG -3¢)and reverse primer (5¢-CCGGCATTGAGGATGCTGAT-3¢) for the sense-strand template, the other with forwardprimer matGIHF (5¢-AACATCCTGGACAGCAAATGCAGGG-3¢)...
  • 11
  • 369
  • 0
Báo cáo khoa học: Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and permeability of Mycobacterium tuberculosis doc

Báo cáo khoa học: Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and permeability of Mycobacterium tuberculosis doc

... GACTAGTTTAAACGGATCGACGAGTTCGACGCppsE2 GACTAGTTTAAACGAGGCACTGTGACCAGATGCppsE3 CGTTCTGGAGCAACCTTCGppsE4 GGTCGAGGAAGTACGTGACres res1 GCTCTAGAGCAACCGTCCGAAATATTATAAAres2 GCTCTAGATCTCATAAAAATGTATCCTAAATCAAATATCPhthiocerol ... AGGAAGGCCGGCAAATGGC2951D TTCACGTGAGATAAGCTCCC2951E ACGGTTTCGGTGAAGCCAG2951L ACAATTAATTAACAGTATGTACGAGCGATGCG2951M ACAAAAGCTTGGCGCAAATCATAGCTTCTTGppsE ppsE1 GACTAGTTTAAACGGATCGACGAGTTCGACGCppsE2 ... (DIM-less) and PMM74 (DIM A- less) mutantstrains to that of the wild-type strain. Mice wereinfected intranasally either with a mixture ofstrains H37Rv:pMV361H and PMM74 or with a mix-ture of strains...
  • 13
  • 536
  • 0

Xem thêm

Từ khóa: báo cáo khoa học nghiên cứu quy trình công nghệ và thiết bị sản xuất thức ăn cho tômtuyên tập cac bao cao khoa học hội nghị khoa học địa i apos abáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP