Gynecological Malignancies: Epidemiological Characteristics of the Patients in a Tertiary Care Hospital in India doc

... in a Tertiary Care Hospital in India Madhutandra Sarkar1*, Hiralal Konar2, DK Raut3 of the cervical cancer cases occur in the developing countries (Sankaranarayanan & Ferlay, 2006) and ... years while that for ovarian carcinoma 46.4 years and endometrial carcinoma 56.0 years. A study done in Larkana, Pakistan (Siyal et al., 1999) had reported that the average age of the patients ... onset of the symptoms reduces with the increase in educational level of the patients (Sarkar et al., 2011), making the management of the disease easier.Median value of PCI of family of the patients...

Factors affecting delays in diagnosis and treatment of pulmonary tuberculosis in a tertiary care hospital in Istanbul, Turkey pptx

... application interval was 31.4 days, mean referral interval was 22.1 days, mean diagnosisinterval was 3.3 days, and mean initiation of treatment interval was 1.4 days. Patient delay waspresent in 34.8 ... and three patients (50.5%) haddelays in diagnosis and 51 patients (25%) had delays in initiation of treatment. The mean (95%, CI) diagnosisinterval was 3.7 days (2.5 to 4.0 days) in male patients and ... A previous reportindicated that 28.4 percent of the patients had patientdelay and that the median application interval was 17.5days [14]. The rate of patient delay was slightly higher in the...

Symptomatology of Gynecological Malignancies: Experiences in the Gynecology Out-Patient Clinic of a Tertiary Care Hospital in Kolkata, India pot

... Gynecology Out-Patient Clinic of a Tertiary Care Hospital in Kolkata, India Madhutandra Sarkar1, 2*, Hiralal Konar3, DK Raut4Madhutandra Sarkar et alAsian Pacic Journal of Cancer Prevention, ... presenting symptom among the patients of ovarian cancer in a hospital of Nigeria. Sultana and Kiyani (2005) in their study conducted in a hospital of Pakistan observed that bleeding per vagina was ... Raut DK (2010). Knowledge and health care seeking behavior in relation to gynecological malignancies in India: a study of the patients with gynecological malignancies in a tertiary care hospital...

Pulmonary Tuberculosis: Knowledge, Attitudes and Practices of Selected Physicians in a Tertiary-Care Hospital docx

... determine the knowledge, attitudes and practices of specialist physicians in a tertiary care hospital as to: a. their idea of the magnitude of TB problem in the Philippines b. their opinion of the ... tertiary care hospital as St. Luke’s realize the magnitude of TB problem in the country. However, the majority does not favorably rate the National TB Program and DOT. The lack of awareness that ... mortality for PTB1 and the economic aspect has always been blamed. The Department of Health, together with the medical societies has been active in their campaign against this dreaded disease....

Accuracy of Clinical Signs in the Diagnosis of Pulmonary Tuberculosis: Comparison of Three Reference Standards Using Data from a Tertiary Care Centre in Rwanda doc

... fits the data. It indicates the amount of the relationship between the variables that remains unex-plained by a model; the larger the value, the poorer the model fits the data. As a rule of thumb, ... Reference Standards Using Data from a Tertiary Care Centre in Rwanda Mugabekazi Julie1, Boelaert Marleen2, Sarushi Joseph1, Seruyange Eric1, Basinga Paulin3, Musemakweli André4, Van der ... clinical and laboratory testing was part of routine examination. For HIV testing, specific informed consent was asked and counseling offered. Approval for this study was obtained from the relevant...

Báo cáo khoa học: Mathematical modelling of the urea cycle A numerical investigation into substrate channelling docx

... 4038–4044]have been interpreted as implying channelling of argininebetween argininosuccinate lyase and arginase in permeabi-lized hepatocytes. To investigate this interpretation further, a mathematical ... urea, argininosuccinate andarginine.Simulating the effect of the addition of 1 mMunlabelledarginine on the distribution of radioactivity in cytoplasmic intermediates of the urea cycleAs the ... similar in terms of an increase in citrulline at the expense of the other labelled metabolites. This can beexplained by the fact that argininosuccinate synthase isinhibited by arginine. Simulations...

Characteristics of Leachate from Citrus Groves and their Changes in the Collecting Reservoirs in Matsuyama, Japan

... 3, Matsuyama 790-8577, Japan ABSTRACT Matsuyama region, located in Shikoku Island, Japan faces the Seto Inland Sea on the west, where the annual rainfall is relatively less than in the other ... the area around the Seto Inland Sea has a small amount of rainfall with a comparatively warm climate, the cultivation of citrus fruits is popular. The ratio of the citrus groves to the total ... as bacteria also played some role along with the algae, because it was observed that SS were also increased through the cultivation and the ratio of the increased amount of SS to the increased...

Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc

... sites in bold type) A IHinfor CATGAAGCTTGCATGGCCGGGGCC (located upstream of furS)IEcorev CGAGAATTCGAAAACGAACGGTGC (located upstream of furS and ending at the 5¢-end of binding site I)B IEcofor ... GTTGAATTCTCGTGTTTATGAGGG (located upstream of furS and beginning at the 3¢-end of binding site I)IPstrev GGAGCTGCAGCCCACGCGATCGCG (located downstream of the start codon of furS)C IIHinfor GGTAAGCTTCTCCAGGGTCAGATG ... see aboveIIIEcorev GCGGAATTCGGGCCGAGGATCGG (located upstream of hbpS and ending at the 5¢-end of binding site III)F IIIEcofor GCCGAATTCCGCCGGACCGGATG (located upstream of hbpS and beginning at...

Báo cáo "Preparation and characteristics of the In-doped ZnO thin films and the n-ZnO:In/p-Si heterojunctions for optoelectronic switch" potx

... ...

Prevalence of presumed ocular tuberculosis among pulmonary tuberculosis patients in a tertiary hospital in the Philippines pdf

... uveitis cases. It has bee n estimated to be under1% in the USA, 4% in China, 6% in Italy, 7% in Japan, and16% in Saudi Arabia [10]. A Southeast Asian neighbor,Thailand, reported a 2.2% systemic ... prospectivestudy in 2002 [8]. Biswas and Badrinath examined 2,010eyes of pulmonary TB patients and found a 1.39% ocularinvolvement [9].Other studies include data about ocular TB as a frac-tion of uveitis ... constitutes a greater proportion of all patients with TB, especially in immunocompromised indi-viduals and the elderly.TB in the eye can manifest in a myriad of ways, and the definitive diagnosis can...

Xem thêm

Từ khóa: morphology and varietal characteristics of the rice plant the formal characteristics of the tenseaspect system advantages and disadvantages of living in a big city and in the country advantages and disadvantages of living in a big city in a small town and in the country advantages and disadvantages of living in a big city and in the countryside finding the standard form of the equation for a conic section Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 chuyên đề điện xoay chiều theo dạng Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam