Báo cáo Y học: The Fe-only nitrogenase and the Mo nitrogenase from Rhodobacter capsulatus A comparative study on the redox properties of the metal clusters present in the dinitrogenase components doc
Báo cáo Y học: The Fe-only nitrogenase and the Mo nitrogenase from Rhodobacter capsulatus A comparative study on the redox properties of the metal clusters present in the dinitrogenase components doc
... 1661 The Fe-only nitrogenase and the Mo nitrogenase from Rhodobacter capsulatus A comparative study on the redox properties of the metal clusters present in the dinitrogenase components Stefan ... Mo- contain-ing nitrogenase from the same organism, showed that: (a) the Fe nitrogenase components can indeed be isolated and purified as intact and catalytically active proteins, and (b) that the ... des-cribed by Sch neider et al.[8].Inviewofthedifficultyinseparating the dinitrogenase (Rc1 Mo ) and dinitrogenase reductase component (Rc2 Mo ) of the Mo nitrogenase from R. capsulatus by DEAE chromatography,...
- 12
- 748
- 0
Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding
... observations seen in the study of Fumeaux et al. (2002) demonstrating that a modification of HLA-DR, post-translationally, may be one mechanism responsible for the low surface expression of monocyte ... confocal imaging to allow visualisation of sections through the cell to observe surface and intracellular staining. Figures 3a- d show the intracellular and surface staining of PBMC in a healthy ... Following an incubation and washing, the primary detection antibody was added, a mouse anti human IgG1 anti-HLA-DR (CR3/43) (Dako, Denmark), at a concentration of 1 µg/ml. After a 2h incubation at room...
- 11
- 618
- 0
Báo cáo y học: Esterified Hyaluronic Acid and Autologous Bone in the Surgical Correction of the Infra-Bone Defects"
... feature allows HA to maintain conformational stiffness and to retain water. One gram of HA can bind up to 6 L of water [6]. As a physical background material, it has functions in space filling, ... and the presence of plaque was registred mesially, buccally, distally, and lingually. Data were obtained at baseline before treatment and at 10 days, and 6,9, and 24 months after treatment. ... has a dual function: on one hand its physiochemical properties facilitate the application of bone graft in the damaged site and on the other hand, it creates an environment with a rich content...
- 7
- 769
- 0
Tài liệu Báo cáo Y học: Electrochemical, FT-IR and UV/VIS spectroscopic properties of the caa3 oxidase from T. thermophilus docx
... spectra of isolatedamino acids as model compounds and information on contributions from the secondary structure from infraredabsorbance spectra and the deconvolution of the amide-Iregion. A particular ... geranyl side chain expected from heme a and a 3. In addition to the signals of the hemes, the reorgan-ization of the polypeptide backbone and amino acid sidechains occurring upon electron transfer ... presented and on this basis the contributions of the reorganization of the polypeptide backbone, of individual amino acids and of the hemes c, a and a 3upon electron transfer to /from the redox active...
- 9
- 528
- 0
Báo cáo Y học: Cloning, chromosomal localization and characterization of the murine mucin gene orthologous to human MUC4 pdf
... membrane-associated mucins are very large and seem to share four common domains: a short cytoplasmicdomain, a transmembrane domain, EGF-like domains and the large O-glycosylated region with an amino-acidsequence ... clone was obtained and named BAC4.Fig. 1. Muc4 cDNA (A) and genomic (B) cloning strategy, and proteindomains organization (C). (A, B) Several cDNA clones and DNAfragments are indicated with their ... amplification of the b-actin cDNA, shown tobe equally expressed in all cDNAs. By Southern blot aneven weaker expression in submaxillary glands, salivaryglands, liver and gallbladder and in kidney...
- 10
- 434
- 0
Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt
... GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGC), 3 (TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC), 4 ( CAACGTCATAGACGATTACATTG CTACATGGAGCTGTCTAGAGGATCCGA). A three-strandjunction was made by o mitting strand ... H., Miyata, T., Mayanagi, K., Yamada, K.,Morikawa, K & S hinagawa, H. (2001) A unique b-hairpin pro-truding from AAA+ATPase domain of RuvB motor protein isinvolved in the interaction with ... strand 4 and a 37-bp duplexDNA by annealing oligonucleotides 5 (bio-AATGCTACAGTATCGTCCGGTCACGTACAACATCCAG) and 6 (CTGGATGTTGTACGTGACCGGACGATACTGTAGCATT).Gel retardation assaysBinding mixtures...
- 9
- 542
- 0
Báo cáo Y học: Purification, characterization and subunits identification of the diol dehydratase of Lactobacillus collinoides pot
... purification, enzymatic characterization and analysis of the composition of the diol dehydratase of L. collinoides.MATERIALS AND METHODSBacteria and culture conditions The lactic acid bacterium ... nondenaturing conditions and revealed one mainband and two weaker bands. Their dissociation by SDS in the second dimension showed that the main band wasreleased into three subunits migrating at the ... dehydratase. After the two-step purification, an aliquot containing dehydratase activity wasfirst separated on 6% nondenaturing polyacrylamide gels. The lanewas cut from the first gel and put on...
- 7
- 392
- 0
Báo cáo Y học: Synthesis, conformational analysis and biological activity of cyclic analogs of the octadecaneuropeptide ODN Design of a potent endozepine antagonist pot
... analog possesses a weakantagonistic activity. The aim of the present study was tosynthesize and characterize cyclic analogs of OP and [D-Leu5]OP. On- resin homodetic backbone cyclization of OP ... secondary structure of the cyclic OP analogsby two-dimensional1H-NMR and molecular dynamicsimulation, and we have investigated the biological activity of these analogs by measuring their ability ... Berkovich, A. &Costa, E. (1989) Isolation and characterization of a rat braintriakontatetraneuropeptide, a posttranslational product of diazepambinding inhibitor: specific action at the Ro...
- 13
- 632
- 0
Báo cáo Y học: Changes in ultrastructure and the occurrence of permeability transition in mitochondria during rat liver regeneration ppt
... Italy;2Department of Zoology, Laboratory of Histology and Comparative Anatomy, University of Bari, Italy;3Center for the Study of Mitochondria and Energy Metabolism (CNR) Bari, ItalyMitochondrial ... cytosolic AAT was stable, therewas a thermal instability of mitochondrial AAT at 70 °C[22]. The activity of mitochondrial AAT was taken as the difference between the two values.Determination ... cytosolic fraction or whole homogenatewere incubated separately at 37 °Cand70°C for 15 min,then AAT activity in both samples was determined. The AAT activity of the sample incubated at 37 °Cwastakentobe...
- 9
- 494
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyensummary a comparative study on invitations in english and vietnamese in terms of crosscultural perspectiveb a thesis a comparative study on making requests in vietnamese and english in terms of politeness2013 quot a comparative study on the antioxidant activity of methanolic extracts from different parts of morus alba l moraceae quot bmc res notes 6 24 pp 1 9báo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP