Báo cáo khoa học: "Toward a Redefinition of Yea/No Questions" pot

... any set of referents {bl, ,bn} that can be partially ordered by a relation O s can support scalar implicature. Any scale S that permits scalar implicature can be represented as a partiallg-ordered ... as b~,th members of a set of Hawaiian cities, he can affirm an unqueried set member (ltilo) to deny a queried member {llawaii). The affirmati,~n of an unqueried ah,'rnate value generally ... the affirmation or denial of more than one scalar h~r a single query, as shown in (10). Ash';nine that Mary and Joe are brother and s:ster and both are known to Q and tL Also, Mary and...

Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

... though. As we have illustrated above and will elaborate below, these words can carry a wide variety of semantic and pragmatic overtones, which render the choice of a marker meaning- driven, as ... be able to derive the discourse relations holding between adjacent text spans, and also to notice the additional semantic and pragmatic implications stemming from the usage of a particular ... words are assigned to the realm of the lexicon, whereas function words are treated as a part of grammar. For dealing with discourse markers, we do not regard this distinction as particularly...

Tài liệu Báo cáo khoa học: "TOWARDS A THEORY OF COMPREHENSION OF DECLARATIVE CONTEXTS " docx

... recognize any given instance of the concept Canada constitutes our concept of Canada. According to a second view, Kant considers a concept as an abstract representation (vorstellung) of the ... TOWARDS A THEORY OF COMPREHENSION OF DECLARATIVE CONTEXTS Fernando Gomez Department of Computer Science University of Central Florida Orlando, Florida 32816 ABSTRACT An outline of a theory ... (concepts as rules and concepts as a structural representation). We have based our analysis on Kant's distinction in order to separate clearly between the organization of the inferences and...

Báo cáo khoa học: The A domain of ﬁbronectin-binding protein B of Staphylococcus aureus contains a novel ﬁbronectin binding site pdf

... GGGGGATCCGGTACAGATGTAACAAATAAAG BamHIrFnBPB163–463R ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG SmaIrFnBPB163–308F GGGGGATCCGGTACAGATGTAACAAATAAAG BamHIrFnBPB163–308R CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA ... GAATTATCTTTAGCTCTAGCTATTGATCCrFnBPB163–480NF F GGATCAATAGCTAGAGCTAAAGATAATTCFnBPB(–142–480)F GCAGAATTCGTCGGCTTGAAATACGCTG EcoRIFnBPB(–142–480)R AATGGATCCTTACTTTAGTTTATCTTTGCCG BamHIFnBPB(388–980)F CCCAAGCTTGATGATGTCAGC Hind ... CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA SmaIrFnBPB309–480F CCCGGATCCTATTTAGGTGGAGTTAGAGATAAT BamHIrFnBPB309–480R AATCCCGGGTTACTTTAGTTTATCTTTGCCG SmaIrFnBPB163–480NF F GAATTATCTTTAGCTCTAGCTATTGATCCrFnBPB163–480NF...

Báo cáo khoa học: "Creating a Corpus of Parse-Annotated Questions" docx

... et al. (2005). The re-search established that even a small amount of ad-ditional training data can give a substantial im-provement in question analysis in terms of bothCFG parse accuracy and ... from appropri-ate treebank material. However, treebank- andmachine learning-based grammatical resources re-flect the characteristics of the training data. Theygenerally underperform on test data ... for a given language or task.Large treebanks are available for major languages,however these are often based on a specific texttype or genre, e.g. financial newspaper text (thePenn-II Treebank...

Báo cáo khoa học: Macrocypins, a family of cysteine protease inhibitors from the basidiomycete Macrolepiota procera pot

... cysteine proteasespapain, cathepsin L and cathepsin V using benzyloxycar-bonyl (Z)-Phe-Arg-7-amido-4-methylcoumarin (AMC) assubstrate, and for legumain with Z-Ala-Ala-Asn-AMC asthe substrate, while ... pooled,concentrated by ultraﬁltration (Amicon UM-10; Millipore,Vienna, Austria) and dialyzed against 0.02 m Tris–HCl, pH7.5. The sample was then applied to a column of DEAE–Sephacel (Pharmacia-LKB, Uppsala, ... proteolyticmechanisms and protein–protein interactions, and asbiocidal agents against various organisms. There areseveral groups of inhibitors, mainly from animal andplant origins, that speciﬁcally...

Báo cáo khoa học: "Generating a Table-of-Contents" pptx

... Table -of- ContentsS.R.K. Branavan, Pawan Deshpande and Regina BarzilayMassachusetts Institute of Technology{branavan, pawand, regina}@csail.mit.eduAbstractThis paper presents a method for the auto-matic ... Most of these approaches are tailored to a par-1The code and feature vector data forour model and the baselines are available athttp://people.csail.mit.edu/branavan/code/toc.ticular domain, ... hierarchical discriminativeapproach for table -of- contents generation. Figure 1shows a fragment of a table -of- contents automat-ically generated by this algorithm. Our methodhas two important points...

Báo cáo khoa học: "Representing a System of Lexical Types Using Default Unification" pdf

... a single value. Moreover, default specifications can be made to act as indefeasible information, using YADU's DefFill operation (Las- carides and Copestake, 1999), that has a TDFS as ... ties about classes of items that behave similarly. This idea is employed in Pollard and Sag's (1987) sketch of an HPSG lexicon as a monotonic mul- tiple orthogonal inheritance type hierarchy. ... and Copestake, 1999), to implement a default inheritance network results in a fully declarative specification of a lexical fragment based on Pollard and Sag's (1987), but that is both...

Tài liệu Báo cáo khoa học: "The Incremental Generation of Passive Sentences" pot

... auxiliary is treated as an argument-attraction verb (cf. Hinrichs & Nakazawa 1991): It subcategorizes for a passive participle and attracts the arguments that the participle subcategorizes ... other approaches to the computational modelling of empirically substantiated features of human language production, such as Kempen & Hoenkamp's (1987) Incremental Procedural Grammar and ... languages such as German and Dutch, where passivization is essentially a morphological process. A different parametrical variation, such as the development of the auxiliary into a syntactic...

Tài liệu Báo cáo khoa học: "Experiments in Reusability of Grammatical Resources" pot

... Experiments in Reusability of Grammatical Resources Doug Arnold ° Toni Badia ®, Josef van Genabith% Stella Markantonatou ° Stefan Momma% Louisa Sadler °, Paul Schmidt ° °Dept of Language and Linguistics, ... automatic, semi-automatic and manual migration of implemented grammatical and lexical resources and of textbook specifications, writ- ten in various 'styles', to the ALEP formalism ... treated. The resulting translation is not as perspicuous, modular, compact and maintainable as the original HPSG specification. Migration results in a fragmen- tation and particularisation of...

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ