0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

... binding loop of cystatin A fulfils the same function as the second binding loops of cystatin B andfamily 2 cystatins and also what residues of this loop in cystatin A may participate in the interaction.To ... energy to the interaction of cystatin B with cysteine proteases [37]. The sequence of the second binding loop of the related family 1 cystatin, cystatin A, differs appreciably from that of cystatin ... binding loop of cystatin A plays a major role in stabilizing the complexes with proteases by retarding theirdissociation. In contrast with cystatin B, only one amino-acid residue of the loop, Leu73, ...
  • 10
  • 533
  • 0
Báo cáo y học:

Báo cáo y học: "Does switching from oral extended-release methylphenidate to the methylphenidate transdermal system affect health-related quality-of-life and medication satisfaction for children with attention-deficit/hyperactivity disorder&

... mayreflect increasing capacity to establish a routine of patchadministration with time, although noncompliance is often underestimated in any clinical trial.Improvements from baseline were also noted ... published study evaluatingMTS wear times of 4 and 6 hours, instead of the 9-hourwear time used in this study, suggests that some late dayside effects may be attenuated by early removal of the patch ... preparation of this manu-script. This assistance was funded by Shire Development, Inc., Wayne, Pennsylvania. The authors also thank the caregivers and children who par-ticipated in the study.References1....
  • 12
  • 757
  • 0
Tài liệu Báo cáo Y học: Purification, characterization, immunolocalization and structural analysis of the abundant cytoplasmic b-amylase from Calystegia sepium (hedge bindweed) rhizomes ppt

Tài liệu Báo cáo Y học: Purification, characterization, immunolocalization and structural analysis of the abundant cytoplasmic b-amylase from Calystegia sepium (hedge bindweed) rhizomes ppt

... found in soybean b-amylase (Cys82, Cys97, Cys208 and Cys343).On the analogy of the soybean b-amylase, the activesite of the C. sepium b-amylase most probably consists of a cleft located between the ... (Carlsbad, CA, USA).Preparation of specific antibodies against b-amylase andC. sepiumRNase-related protein (CalsepRRP)Polyclonal antibodies were raised against b-amylase and the unglycosylated ... for kinetic analyses of purified b-amylases. In a thirdmethod the degradation of starch was determined by the iodine staining method [21]. The reaction was started by adding 100 mL of the enzyme...
  • 11
  • 611
  • 0
Tài liệu Báo cáo Y học: Bivalent cations and amino-acid composition contribute to the thermostability of Bacillus licheniformis xylose isomerase doc

Tài liệu Báo cáo Y học: Bivalent cations and amino-acid composition contribute to the thermostability of Bacillus licheniformis xylose isomerase doc

... corresponding dialysis buffer. The dialysisbuffer was used to generate the baseline. The enzymecontaining both Mg2þand Co2þwas dialyzed against buffer A, then scanned against the dialysis buffer ... patterns in the amino-acidcomposition of hyperthermophilic proteins is the biasagainst thermally labile amino-acid residues. This pattern is obvious on examination of the amino-acid compositions of the ... inactivation and the temperature at which the enzyme starts inactivating at a measurable rate increasefrom the apoenzyme to the Mn2þ-containing enzyme, loss of the metal cofactor could be the...
  • 11
  • 478
  • 0
Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf

Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf

... bonds with the e-carboxylate of glutaryl-CoA and t hat the latter s erine is located within thissubdomain. It is remarkable that both residues are appar-ently replaced by stretches of rather hydrophobic ... The most likelycandidate for the catalytic glutamate of propionate CoA-transferase based on these data was glutamate 324 (Fig. 3 ).Detection of glutamate 324 as the catalyticcarboxylate of ... carboxylates. A critical step in the reductive branch of this pathway is the activation of (R)-lactate as its (R)-lactoyl-CoA derivative.This reaction is carried out by the enzyme propionate:ace-tyl-CoA...
  • 9
  • 498
  • 0
Báo cáo Y học: Purification, characterization and subunits identification of the diol dehydratase of Lactobacillus collinoides pot

Báo cáo Y học: Purification, characterization and subunits identification of the diol dehydratase of Lactobacillus collinoides pot

... step of an anaerobic metabolism pathway. The aldehyde produced by these dehydratases can then bedismuted, allowing regeneration of NADH by an alcoholdehydrogenase and/or the ATP synthesis involving ... 1,2-ethanediol and 8.3 mMfor glycerol. The enzymerequired the adenosylcobalamin coenzyme for catalyticactivity and the Kmfor the cofactor was 8 lM. Inactivation of the enzyme was observed by ... subunits of 52 kDa each [13]. Upto now, this is the only communication of the composition of a dehydratase enzyme obtained by purification in thisbacterial genera.L. collinoides is a lactic acid bacterium...
  • 7
  • 392
  • 0
Báo cáo Y học: Amphibian peptides that inhibit neuronal nitric oxide synthase The isolation of lesueurin from the skin secretion of the Australian Stony Creek Frog Litoria lesueuri docx

Báo cáo Y học: Amphibian peptides that inhibit neuronal nitric oxide synthase The isolation of lesueurin from the skin secretion of the Australian Stony Creek Frog Litoria lesueuri docx

... wasinhibited by 96%. Frenatin 3 inhibitied calcineurin by 38%at 46 lM, a concentration that is 6.8-fold g reater than the IC50against nNOS. Finally, caerin 1.9 inhibited c alcineurin by 48.1% at 19.3 ... assaysAntimicrobial testing. Synthetic lesueurin was t ested forantibiotic activity by the M icrobiology D epartment o f the Institute of Medical and Veterinary Science (Adelaide,Australia) by a standard method ... (b) the electron-supplying reductasedomain that binds NADPH, FAD a nd FMN. Communi-cation between the oxygenase and reductase domains is determined by the regulatory enzyme calmodulin thatinteracts...
  • 10
  • 463
  • 0
Báo cáo Y học: Conformational analysis by CD and NMR spectroscopy of a peptide encompassing the amphipathic domain of YopD from Yersinia potx

Báo cáo Y học: Conformational analysis by CD and NMR spectroscopy of a peptide encompassing the amphipathic domain of YopD from Yersinia potx

... 2002Conformational analysis by CD and NMR spectroscopy of a peptideencompassing the amphipathic domain of YopD fromYersiniaTobias Tengel1, Ingmar Sethson1and Matthew S. Francis21Departments of ... distribution of these amino acids appeared crucialfor binding the LcrH chaperone [13], we wished to extendthese findings using a chemical approach. In particular, thisinitial study aimed at obtaining the ... the role of the YopD–LcrH complex in Yersinia pathogenesis by determining the a helical structure of the biologicallyrelevant C-terminal amphipathic domain of YopD. Impor-tantly, this domain precedes...
  • 10
  • 447
  • 0
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc

Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc

... pBottomO1O2O2clO3O2croO1O1+–––1405'CATTTTCTTACCTCCTTAAATTTACCTATAGTATAACCCAATTATTTTTGGTATTCAGTAAAAGAATGGAGGAATTTAAATGGATATCATATTGGGTTAATAAAAACCATAAGTACAAAAAAATACACGAAAAGCAAACTTTTATGTTGACTCAAGTACACGTATCGTGTATTGTTTTTTTATGTGCTTTTCGTTTGAAAATACAACTGAGTTCATGTGCATAGCACATAAGTAGGTTTTGTAAGCGGGAGGTGACAACATGTCATCCAAAACATTCGCCCTCCACTGTTGTAC ... binding capacity of the repressor of temperateStaphylococcus aureus phage /11Tridib Ganguly*, Malabika Das*, Amitava Bandhu, Palas K. Chanda, Biswanath Jana, RajkrishnaMondal and Subrata SauDepartment ... pBottomO1O2O2clO3O2croO1O1+–––1405'CATTTTCTTACCTCCTTAAATTTACCTATAGTATAACCCAATTATTTTTGGTATTCAGTAAAAGAATGGAGGAATTTAAATGGATATCATATTGGGTTAATAAAAACCATAAGTACAAAAAAATACACGAAAAGCAAACTTTTATGTTGACTCAAGTACACGTATCGTGTATTGTTTTTTTATGTGCTTTTCGTTTGAAAATACAACTGAGTTCATGTGCATAGCACATAAGTAGGTTTTGTAAGCGGGAGGTGACAACATGTCATCCAAAACATTCGCCCTCCACTGTTGTAC 5'–130 –120 –110 –100 –90–80–70–20–10+1–60 –50 –40 –30Fig. 3. Interaction of...
  • 11
  • 432
  • 0
Báo cáo y học:

Báo cáo y học: "CEO- CNE Relationships: Building an Evidence-Base of Chief Nursing Executive Replacement Costs"

... Micro-costing % of plant depreciation & inventory Incalculable Process Evaluation by Administrative Team 3,000 3,000 Patient & Employee Satisfaction Survey Statistical Analysis (over 1 year) ... sent. Data Analysis Data was computer-entered by a Graduate Re-search Assistant (GRA) and double-checked by the Principal Investigator (PI). The project statistician performed summary and correlational ... Health-care financial instability caused by such major change in management is enormous and initiates placing the facility in crisis mode. Kippenbrock and May feel that hospitals least likely to...
  • 9
  • 440
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo giáo dục thể chất trường tiểu họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP