0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo Y học: Ribosome-associated factor Y adopts a fold resembling a double-stranded RNA binding domain scaffold potx

Báo cáo Y học: Ribosome-associated factor Y adopts a fold resembling a double-stranded RNA binding domain scaffold potx

Báo cáo Y học: Ribosome-associated factor Y adopts a fold resembling a double-stranded RNA binding domain scaffold potx

... ribosome associated factor Y (Eur. J. Biochem. 269) 5191 Ribosome-associated factor Y adopts a fold resembling a double-stranded RNA binding domain scaffold Keqiong Ye1, Alexander Serganov1, ... genomes,and in Arabidopsis thaliana and Spinacia oleracea plantsequences. A search usingFASTA[34] andBLAST[35]revealed only a few hits with significant identity associatedwith two strains of Salmonella ... structure of a 112-residue pY and have studied itsbackbone dynamic by NMR spectroscopy. The structurehas a babbba topology and represents a compact two-layered sandwich of two nearly parallel a helices...
  • 10
  • 337
  • 0
Tài liệu Báo cáo khoa học: Tissue factor pathway inhibitor is highly susceptible to chymase-mediated proteolysis pptx

Tài liệu Báo cáo khoa học: Tissue factor pathway inhibitor is highly susceptible to chymase-mediated proteolysis pptx

... tryptase. Biochemistry 40, 7342–7349.18 Nakahara Y, Miyata T, Hamuro T, Funatsu A, Miyagi M, Tsunasawa S & Kato H (1996) Aminoacid sequence and carbohydrate structure of a recom-binant ... H,Ishihara M, Yonemura H, Miyamoto S, Funatsu A, Enjyoji K, Abumiya T, Miyata T & Kato H (1994)Amino acid sequence and inhibitory activity of rhesusmonkey tissue factor pathway inhibitor ... N (1997) Chymase clea-vage of stem cell factor yields a bioactive, soluble pro-duct. Proc Natl Acad Sci USA 94, 9017–9021.48 Nakano A, Kishi F, Minami K, Wakabayashi H,Nakaya Y & Kido...
  • 13
  • 361
  • 0
Tài liệu Báo cáo khoa học: Platelet factor 4 disrupts the intracellular signalling cascade induced by vascular endothelial growth factor by both KDR dependent and independent mechanisms ppt

Tài liệu Báo cáo khoa học: Platelet factor 4 disrupts the intracellular signalling cascade induced by vascular endothelial growth factor by both KDR dependent and independent mechanisms ppt

... lgÆmL)1). Raf1 activity was quantified after Raf1 immunop recipitation, by means of an in vitrokinase assay. Raf1 specific activity i s expressed as relative activity (C). Values a re m eans ± SD ... CXCR3B (forward) 5¢-TGCCAGGCCTTTACACAGC-3¢; (reverse) 5¢-TCGGCGTCATTTAGCACTTG-3¢.GAPDH (forward) 5¢-CCACCCATGGCAAATTCCATGGCA-3¢; (reverse) 5¢-TCTAGACGGCAGGTCAGGTCCACC-3¢.Flow cytometryCells ... Beverly, MA, USA). Anti-PLCc1,anti-phosphotyrosine (4G10) I gs and the Raf1 immunopre-cipitation kinase cascade assay kit were obtain ed fromUpstate Biotechnology (Lake Placid, NY, USA). Anti-CD-31...
  • 9
  • 400
  • 0
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf

Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf

... a multigene family is regulated by transcription factor TFIIIBAkhila Parthasarthy and Karumathil P. GopinathanDepartment of Microbiology and Cell Biology, Indian Institute of Science, Bangalore, ... derivative of tRNAGly1-1 has a single TATA ele-ment at )130 bp and is transcribed to the same levels as theparent. pmutRKX3 has the single TATATAA element ofpRKX3 mutated to GATATCA. tRNAGly1-6,7 ... overall availability of transcription factors.We made a comparative analysis of two tRNAGly1gene copies, which belonged to the highly and poorlytranscribed groups. The lower stability of...
  • 15
  • 484
  • 0
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

... 17] a s a template and the primersRRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGAAGAAAAATAATGAAC-3¢, SacI site underlined) andTorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGCTTGATGTAATC-3¢, BamHI site underlined). ... 5B, lane 10). Similarly, steady state analysis did not A BFig. 4. In vivo analysis of S ufI export in Dtig, DdnaKdnaJ and DtigDdnaKdnaJ mu tants. S teady state (A) and pulse-chase (B) analysis ... beenidentified as a second post-translational targeting/trans-location pathway t hat operates i ndependently of the Secpathway (reviewed in [11]). In contrast to the Sec pathway,the Tat pathway has the...
  • 9
  • 393
  • 0
Báo cáo khoa học: Nuclear factor TDP-43 can affect selected microRNA levels pptx

Báo cáo khoa học: Nuclear factor TDP-43 can affect selected microRNA levels pptx

... possibility thatwarrants experimental testing in the future.let-7b RNA Pol IImiR-663 RNA Pol IImiR-574-5p RNA Pol IImiR-558 RNA Pol IIm7GAAAAAm7GAAAAAm7GAAAAAm7GAAAAApri-let-7bpri-miR-663pri-miR-574-5ppri-miR-558pre-miRNAmiRNATDP-43Gene(s) ... antibody (Abcam, Cambridge, MA, USA).Microarray and direct miRNA analysisTotal RNA from TDP-43 siRNA, control siRNA-treated(siCONTROL nontargeting siRNA #2) and untreatedHep-3B cells were obtained ... glyceraldehyde-3-phosphatedehydrogenase; GST, glutathione S-transferase; LAMC1, laminin, gamma 1 (formerly LAMB2); miRNA, microRNA; siRNA, short inhibitory RNA; STX3, syntaxin 3; VAMP3, vesicle-associated membrane...
  • 14
  • 225
  • 0
Báo cáo khoa học: Complement factor 5a receptor chimeras reveal the importance of lipid-facing residues in transport competence doc

Báo cáo khoa học: Complement factor 5a receptor chimeras reveal the importance of lipid-facing residues in transport competence doc

... USA2 Laboratory for Molecular Cardiology, Danish National Research Foundation Centre for Cardiac Arrhythmia, The Heart Centre, CopenhagenUniversity Hospital, Denmark3 Laboratory for Molecular ... display a lower binding affinity similar tothe BFA-treated wild-type receptor and, based on ourlocalization data, fail to reach the plasma membrane.This internal receptor population is properly ... Molecular Cardiology, Danish National Research Foundation Centre for Cardiac Arrhythmia, Department of Neuroscienceand Pharmacology, University of Copenhagen, Denmark4 Department of Biochemistry and...
  • 15
  • 365
  • 0
Báo cáo khoa học: Nuclear factor kappa B and tumor necrosis factor-alpha modulation of transcription of the mouse testis- and pre-implantation development-specific Rnf33⁄Trim60 gene pot

Báo cáo khoa học: Nuclear factor kappa B and tumor necrosis factor-alpha modulation of transcription of the mouse testis- and pre-implantation development-specific Rnf33⁄Trim60 gene pot

... this work and were maintained at the Laboratory Ani-mal Centre of the National Yang Ming University, Taipei.This study was approved by the Institutional Animal Careand Use Committee (IACUC) of ... statistical analysis of the luciferase assay data; values ofP < 0.05 were considered significant.Preparation of nuclear extracts and total proteinlysatesNuclear extracts and protein lysates ... (5¢-GCCTCCTGCACCACCAACTG-3¢) andGAPDH-R (5¢-CCAGTAGAGGCAGGGATGATGT-3¢).The real-time PCR program was: pre-incubation at 50 °C for2 min; initial denaturation at 95 °C for 7 min; and 45 cyclesat 95...
  • 14
  • 381
  • 0
Báo cáo khoa học: Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor 1 pot

Báo cáo khoa học: Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor 1 pot

... triplicate.GALNS enzyme activityGALNS activity was assayed with 4-methylumbeliferyl-b-d-galactopyranoside-6-sulfate (Toronto Chemicals Research,North York, Canada) as a substrate. The enzyme assaywas ... [2].Keywordsadeno-associated virus-derived vector;cytomegalovirus immediate earlyenhancer ⁄ promoter; mucopolysaccharidosisIVA; N-acetylgalatosamine-6-sulfatesulfatase; sulfatase-modifying factor ... Surolia I, Chouthai N,Zhao W, Maina N, Srivastava A & Stacpoole P (2008) A combined therapeutic approach for pyruvate dehy-drogenase deficiency using self-complementary adeno-associated...
  • 12
  • 460
  • 0
Báo cáo khoa học: Transcription factor specificity protein 1 (SP1) and activating protein 2a (AP-2a) regulate expression of human KCTD10 gene by binding to proximal region of promoter pot

Báo cáo khoa học: Transcription factor specificity protein 1 (SP1) and activating protein 2a (AP-2a) regulate expression of human KCTD10 gene by binding to proximal region of promoter pot

... TGTGGCTCTGTGGAACATTTSp1FP GGACTACCTGGAGTGATGCCTAASp1RP CCCATCAACGGTCTGGAACTAP-2aFP CAACGTTACCCTGCTCACATCA Real-time PCRAP- 2a RP CAGGTCGGTGAACTCTTTGCAb-actinFP GCGCGGCTACAGCTTCAb-actinRP CTTAATGTCACGCACGATTTCCFig. ... ChIPSp1 ⁄ chipF GGACTACCTGGAGTGATGCCTAA ChIPSp1 ⁄ chipR CCCATCAACGGTCTGGAACT ChIPAP- 2a ⁄ si GCUCCACCUCGAAGUACAATT RNAiSp1 ⁄ si NNAGCGCUUCAUGAGGAGUGA RNAiKCTD10FP TTGCGGTTTAGGTACATCCAKCTD10RP TGTGGCTCTGTGGAACATTTSp1FP ... +30)-F5 GGGGTACCAACGGACGGCTTAAGACGTTP()13 ⁄ +30)-F6 GGGGTACCCCGGCTGGCGTGAGCTGGGTP()609 ⁄ )241)-R CCAAGCTTTTCCTTCCCGGGCGAAGAAGAP- 2a ⁄ chipF GGGGCGGAAGTGGGGTG ChIPAP- 2a ⁄ chipR GAAAAGTCGGAGGACG ChIPSp1...
  • 11
  • 409
  • 0

Xem thêm

Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam