0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

... examined the effects of SA on stress response in mammalian cells using a simple screening system, andrevealed that SA is a potent Hsp inducer in mammalian cells, thereby protecting cells against ... Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells Keiichi Ishihara, Kenji Horiguchi, Nobuyuki Yamagishi and ... heat shockproteins such as Hsp1 0 5a and Hsp7 0 in various mammalian cells. Enhancement of thermoresistance of cells by SAUpon exposure to a sublethal heat treatment, mammalian cells acquire transient...
  • 8
  • 470
  • 0
Báo cáo khoa học: Neuroserpin Portland (Ser52Arg) is trapped as an inactive intermediate that rapidly forms polymers Implications for the epilepsy seen in the dementia FENIB ppt

Báo cáo khoa học: Neuroserpin Portland (Ser52Arg) is trapped as an inactive intermediate that rapidly forms polymers Implications for the epilepsy seen in the dementia FENIB ppt

... nondenaturing andtransverse urea gradient PAGE, and activity was assessedagainst tPA [6].Complex formation assaysWild-type and Ser52Arg neuroserpin were incubated i nvarious ratios with tPA at ... faster rate, in keeping with the more severe clinicalphenotype. The P ortland mutant h as a normal unfoldingtransition in urea and a normal melting temperature but isinactive as a proteinase inhibitor. ... isoelectrofocusing PAGE.Ser52Arg neuroserpin is inactive as an inhibitor of tPAWild-type neuroserp in forms complexes with t PA with a stoichiometry of inhibition of 1 and an association rateconstant...
  • 8
  • 495
  • 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... C), for pGEX–EWS; EAD forward d(CGGAAT TCA TGG CGT CCA CGG ATT ACA G) and EADreverse d(CGC TCG AGT CAT CCG GAA AAT CCTCCA GAC T), for pGEX–EAD; RGG1 forward d(CGGAAT TCC CAG GAG AGA ACC GGA ... G-quadruplex DNA. (A) EMSAwas performed with EWS (lanes 2 and 4) and32P-labeled ETS-1(lanes 3 and 4) or ssDNA L (lanes 1 and 2). (B) EMSA was per-formed with EWS (lanes 2, 4 and 6) and32P-labeled ... protein as a G-quadruplex DNA- and RNA-binding proteinKentaro Takahama1,*, Katsuhito Kino2,*, Shigeki Arai3, Riki Kurokawa3and Takanori Oyoshi11 Department of Chemistry, Faculty of Science,...
  • 11
  • 786
  • 0
Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... AAG CCG ATG ACA CCA ATT (asd sense) This studyasd2 GCA GGT TCA TAG TGC ATG (asd antisense) This studyKan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19]Kan FP CTC ATC GAG CAT CAA ATG (kanamycin ... Catlin BW (1990) Branhamella catarrhalis: an organismgaining respect as a pathogen. Clin Microbiol Rev 3,293–320.2 Karalus R & Campagnari A (2000) Moraxella catarrh-alis: a review of an ... bacteria of eachstrain using an RNeasy Mini kit and treated with an on-column RNase-Free DNase set (Qiagen). The first-strand synthesis of cDNA was primed with random primers using a high-capacity...
  • 14
  • 674
  • 0
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

... TGACCAAGGCAACAGAACCAAATCAGACGGCCGGTATGTGHeat shock 70 kDa protein 1 2A CGAAAAAGGACAGCAGTTGAAACTCATCCTCCACCGGATTGT HSP2 3 CGTCCGATTTCTTCTCGTGTTTACCAGAAGACATTACAGTGAAAATTGAChaperonin-containing ... 7, isoform b, isoform 1 GGGAACCAGCAGTCGTCAAACGTCCACTGAGAGGATGAGACAInhibitor of kappa light polypeptide enhancer in B cells, kinasecomplex-associated proteinAAAGCAGAGCAGAAAAAGTGGAAGGACAATGCCGCGATCAGNon-selenium ... GCCCCCCTCCCACACACATCTTCGGCCGTCTTTCCCTSL GTTCTTGTTCCTGCTCATCAGTATGTGGATCGCCAAAAACTCATGQM protein AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAAHYPK GGAAATGGAAATAACAAGACAAATAGCGCGCAACTAATGCTTCCACAA HSP7 0...
  • 11
  • 570
  • 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... byinvertebrates, and has three crystal phases: calcite, ara-gonite and vaterite. Although calcite is the most stablecrystal thermodynamically, many organisms can formmetastable aragonite crystals ... cDNA and DNA encoding OMM-64To obtain cDNA clones encoding proteins contained in the HMW aggregate, immunoscreening was performed using an antiserum that reacts mainly with the aggregate in ... intensity of the immunoreactive band in the HMW region wasdecreased and a new band was detected at 64 kDa, butonly after treatment with heparitinase II (Fig. 5A) .Although the same band was obtained...
  • 12
  • 568
  • 0
Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

... cerevisiaestrain GIL77Two oligo DNAs (5¢-CTTCGTCGACAAGATGTGGAGGTTGAAGATA-3¢ and 5¢-GTCCGCTAGCTCAAGGCAAAGGAACTCTTCT-3¢), corresponding to the N- andC-terminal sequences of b-amyrin synthase from ... struc-tures of soyasapogenol A, soyasapogenol B, andsoyasapogenol E, oleanene sapogenols from soybean,structures of soyasaponin I, soyasaponin II, and soyasa-ponin III. Chem Pharm Bull 30, ... for soyasapogenol A is not as simple as that for soyasapogenol B, andthe presence of additional hydroxylases must beconsidered. Fortunately, the aglycone of the majorsoyasaponins is soyasapogenol...
  • 12
  • 704
  • 0
Tài liệu Báo cáo khoa học: Identification of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

Tài liệu Báo cáo khoa học: Identification of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

... on a functional STAT2 DNA bindingdomain do not appear to play an important role in mediating the transcription of these genes.The c-fos gene was examined in this system as an example of a GAS-driven ... VV-II cells using relative quantitative real-time PCR as for Fig. 2. For each sample,b-actin was evaluated as a reference gene and used for normaliza-tion. For each gene, data are presented as ... IFN-inducible transcriptional activation in the absence of the STAT2 DNA binding domain as determined by Affymetrix DNA microarrayanalysis. Total mRNA samples from U 6A- 2, U 6A- 2VV-II and U 6A cells...
  • 13
  • 459
  • 0
Tài liệu Báo cáo khoa học: Identification of membrane-bound serine proteinase matriptase as processing enzyme of insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1/angiomodulin/mac25) doc

Tài liệu Báo cáo khoa học: Identification of membrane-bound serine proteinase matriptase as processing enzyme of insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1/angiomodulin/mac25) doc

... The main fraction contained a 75 kDamatriptase as a major component and a few contamin-ating proteins as analyzed by SDS ⁄ PAGE.RNAi experiments with OVISE cells Matriptase siRNAs and a scrambled ... 5¢-GGAUCAAAGAGAACACUGGGGUAUA-AG-3¢;and #1513 sense, 5¢-AGUUCACGUGCAAGAACAAGUUCUG-AG-3¢. The forward sequence of the scrambledRNA was 5¢-GAUCCAAGUAAUACAGAGAUGGGAGAG-3¢. OVISE cells were plated the day before ... same sample contain-ing 10 lg protein was subjected to immunoblotting with theantimatriptase antibody M32. The bar indicates a gelatinolytic bandat approximately 80 kDa in lane 1 and a matriptase...
  • 13
  • 603
  • 0
Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

... ACCACTTTGTACAAGAAAGCTGGGTyef1hisfCAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAATATGCGTACGCTGCAGGTCGACyef1hisrGAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCGTTAATCGATGAATTCGAGCTCGpos5hisfCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCGTACGCTGCAGGTCGACpos5hisrCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAATCGATGAATTCGAGCTCGpos5leu21.6fCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCCAATTCTGTGTTTCCCGGAAATGpos5leu21.6rCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAGTAAAGTTCGTTTGCCGATACATGyef1up0.5kbCGTTATGAAAATCACTATTATCCCCyef1-HindIII ... cerevisiae is underlined.Primer Oligonucleotide sequencesyef1-attB1FSD AAAAAGCAGGCTCCGAAGGAGATATAAAAATGAAAACTGATAGATTACTGyef1-attB2R AGAAAGCTGGGTGGATTGCAAAATGAGCCTGACattB1 ACAAGTTTGTACAAAAAAGCAGGCTattB2 ... ACAAGTTTGTACAAAAAAGCAGGCTattB2 ACCACTTTGTACAAGAAAGCTGGGTyef1hisfCAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAATATGCGTACGCTGCAGGTCGACyef1hisrGAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCGTTAATCGATGAATTCGAGCTCGpos5hisfCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCGTACGCTGCAGGTCGACpos5hisrCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAATCGATGAATTCGAGCTCGpos5leu21.6fCATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAAATGCCAATTCTGTGTTTCCCGGAAATGpos5leu21.6rCTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGTTTAGTAAAGTTCGTTTGCCGATACATGyef1up0.5kbCGTTATGAAAATCACTATTATCCCCyef1-HindIII...
  • 13
  • 560
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM