... gives
an explanation for the difference between aspectual
information understood as a view on a situation and
temporal features of a situation. The former can be
gained after applying a certain ...
ation.
Moreover, this data disproves B/~uerle's explana-
tion of (1), clarifies Smith's definition of a viewpoint
and motivates the need for a neutral viewpoin...
...
Bolt, Beranek and Newman, Inc.
Cambridge, MA 02239
Kathy Starr
Bolt, Beranek and Newman, Inc.
Cambridge, MA 02239
ABSTRACT
A desirable long-range goal in building
future speech understanding ... Norma Peterson, and Mike
Nivens for helping to organize the experiment and
transcript preparation. Than~s also go to Sharon
Oviatt, Marilyn Adams, Chip Bruce, Andee Rubin,
Pay Per...
... users' grammatical and ungrammatical forms
demonstrates the sufficiency of a very restricted grammar of
English for a natural language interface to an advisory sys*
tem. The users' language ... strategies to handle ungrammatical
input, and some parsing heuristics portable to any natural
language interface to advisory systems. This strategy would
increase the habitabili...
... Kaul P, Sathish HA & Prakash V (2002) Effect of metal
ions on structure and activity of papain from Carica
papaya. Nahrung 46, 2–6.
35 Akhtar MS, Ahmad A & Bhakuni V (2002) Divalent
cation ... Uchida Y, Ohshima T, Sasaki Y, Suzuki H, Yanai S,
Yamashita N, Nakamura F, Takei K, Ihara Y,
Mikoshiba K et al. (2005) Semaphorin 3A signalling
is mediated via sequential Cdk5 and GSK3b...
... by
measurement of anomeric protons area.
This led to 14 possible combinations: (B ¼ b-Rha,
A ¼ a- Rha,
A ¼ a- Fuc3NAc (1fi2) a- Rha)
B A, B–
A
B A A, B A
A, B A A, B A A
B A A A, B A A
A, B A A A, ... bold):
B A B A, B A B–
A, B A A A, B A A A, B A A A/
B, A A A, A A B,
A A B, B A B, B A A, B A A, A
A B (Table 1).
In summary, eight of the 14 possible combinations could
be as...
... K, Hieda N, Yamanishi M, Shibata N &
Toraya T (2005) Crystallization and preliminary X-ray
analysis of molecular chaperone-like diol dehydratase-
reactivating factor in ADP-bound and nucleotide-free
forms. ... the a, b and c subunits of the
enzyme are abbreviated as a
D
, b
D
, and c
D
, respectively,
and the a and b subunits of the reactivase are abbrevi-
ated as a
R...
... DNA
sequences flanking the Jannaschia sp. CCS1 HYD
Js
revealed an ORF encoding a putative allantoate amido-
hydrolase, which is part of the urate catabolic pathway
in many organisms [8]. In fact, ... molecular basis of enzyme thermosta-
bility. J Bacteriol 185, 4038–4049.
20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka
Y & Takahashi S (1997) Process for producing d-N-car-
bamoyl -a-...
... template
using Deep Vent DNA polymerase (New England Biolabs,
Ipswich, MA, USA), a sense primer (CATATGGCTAGC
ATGCGCATATTGCTGAGTAAC) containing an NheI site
and an antisense primer (TTAGGATCCTTACCATTGCG
TGCCAACTCCCAC) ... pro-
tein is made up of a nine-stranded b-sheet flanked by
a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1
Structure of Salmonella typhimurium SurE...
... an N-terminal Nco1 cloning site.
The forward o ligomer 5 ¢-TCCGAAACCAGCG GCCGCTT
TATCGCGTTA AAAC CGGT GATCAA ACCCC -3¢ and the
reverse oligomer 5¢-GTAGGCCTT TGAATTCCTCAAAA
AGTGCGGCTCGAT-3¢ were ... points
over 60 s, and an average value was taken as a data point.
Titrations were continued until a stable anisotropy value
was obtained.
Fluorescence anisotropy, A, is defined as
A ¼ðI...