Báo cáo khoa học: "Modeling Human Sentence Processing Data with a Statistical Parts-of-Speech Tagger" ppt
Báo cáo khoa học: "Modeling Human Sentence Processing Data with a Statistical Parts-of-Speech Tagger" ppt
... COLING/ACL 2006 Student Research Workshop, pages 25–30,Sydney, July 2006.c2006 Association for Computational LinguisticsModeling Human Sentence Processing Data with a Statistical Parts-of-Speech ... empirical sentence process-ing data. We use two modes of evaluation:one that relies on comparison with a con-trol sentence, paralleling practice in hu-man studies; another that measures prob-ability ... onto the human sentence processing mechanism (HSPM). Primafacie it seems unlikely that such a tagger will beadequate, because almost all previous researchershave assumed, following standard linguistic...
- 6
- 344
- 0
Báo cáo khoa học: New human and mouse microRNA genes found by homology search pptx
... exons generating stableRNA products. Nature 379, 464–466.36 Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M,Marks D, Snyder B, Gaasterland T, Meyer J &Tuschl T (2003) The small RNA profile ... RNAs. Science 294, 853–858.15 Griffiths-Jones S, Bateman A, Marshall M, Khanna A & Eddy SR (2003) Rfam: an RNA family database.Nucleic Acids Res 31, 439–441.16 Kim J, Krichevsky A, Grad ... mRNA, whereashsa-mir-143 resides outside of the mRNA. These specialcases will probably be more fully understood whenadditional transcripts are available in the data bases.The three miRNA clusters...
- 15
- 372
- 0
Tài liệu Báo cáo khoa học: "Bilingually Motivated Domain-Adapted Word Segmentation for Statistical Machine Translation" pptx
... results across dif-ferent data conditions.1 IntroductionState-of-the-art Statistical Machine Translation(SMT) requires a certain amount of bilingual cor-pora as training data in order to achieve ... segmentation can achieve state-of-the-artperformance. Moreover, our approach can easilybe scaled up to larger data sets and achieves com-petitive results if the small data used is a represen-tative ... introduce a word segmentation ap-proach to languages where word bound-aries are not orthographically marked, with application to Phrase-Based Statis-tical Machine Translation (PB-SMT). In-stead...
- 9
- 236
- 0
Báo cáo khoa học: "Analysis of Selective Strategies to Build a Dependency-Analyzed Corpus" pptx
... developedsuch as rule-based analyzers and corpus-basedanalyzers that use machine-learning techniques.However, the maximum accuracy achieved bystate-of-the art analyzers is almost 90% for news-paper articles; ... human to annotate. Under this framework, the system hasaccess to a large pool of unlabeled data, and it hasto predict how much it can learn from each candi-date in the pool if that candidate is labeled.Most ... perfor-mance. Actually, Sasano tried to expand the fea-ture set for a Japanese dependency analyzer usingSVMs in (Sasano, 2004), with a small improve-ment in accuracy.To write rules for a rule-based...
- 8
- 488
- 0
Báo cáo khoa học: "Encoding Lexicalized Tree Adjoining Grammars with a Nonmonotonic Inheritance Hierarchy" potx
... categories and feature information and there is at least one leaf node labeled with a lexical category (such lexi- cal leaf nodes are known as anchors). For example, the canonical tree for a ditransitive ... the same way that the covariation of, say, syntactic and mor- phological form is treated. In particular, we can use the mechanisms that DATR already provides for fea- ture covariation, rather ... agree that adopting a hierarchical approach provides the best available solution to it. However, rather than creating a hier- archical lexical formalism that is specific to the [_TAG problem,...
- 8
- 349
- 0
Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt
... molecularmechanism for the Arg-tRNA synthetase-catalyzed deacylation of Arg-tRNA (Arg-tRNA + AMP fi Arg-AMP + tRNA at high pH), in whichthe deacylation of aminoacyl-tRNA bound on Arg-tRNA synthetase ... nucleotides (AGCCA1 7a GGAC2 0a A), respectively.The P. horikoshii tRNAArgCCUgene (5¢-GGACCGGTAGCCTAGCCA1 7a GGAC2 0a AGGG CGGCGGCCTCCTAAGCCGCAGGTCCGGGGTTCAAATCCCCGCCGGTCCGCCA-3¢) was cloned with ... MgCl2under a linear gradient of NaCl from 0 to 2 m gave a puretRNAArgtranscript, which was precipitated by addition ofethanol.Aminoacylation reactionThe aminoacylation reaction of tRNA was measured...
- 17
- 512
- 0
Tài liệu Báo cáo khoa học: Transduced human PEP-1–heat shock protein 27 efficiently protects against brain ischemic insult pptx
... Stephanou A, Wagstaff MJ, Coffin RS, Mar-ber MS, Engelmann G & Latchman DS (1999) Heatshock protein delivered with a virus vector can protectcardiac cells against apoptosis as well as against ... incubated with rabbit anti-ionizedcalcium-binding adapter molecule 1 (iba-1) (1 : 500; Wako,Osaka, Japan) and subsequently exposed to biotinylatedgoat anti-rabbit IgG and streptavidine peroxidase ... 312–318.35 Araham H, Losonczy A, Czeh G & Lazar G (2001)Rapid activation of microglial cells by hypoxia, kainicacid, and potassium ions in slice preparations of the rathippocampus. Brain Res...
- 13
- 468
- 0
Tài liệu Báo cáo khoa học: "Modeling the Translation of Predicate-Argument Structure for SMT" ppt
... translation using semantic features. Thetwo models are integrated into a state-of-the-art phrase-based machine translation systemand evaluated on Chinese-to-English transla-tion tasks with ... onlyverbal predicates are semantically important,they also form a major part of the sentences.Therefore, whether verbal predicates are trans-lated correctly or not has a great impact on thetranslation ... particular, we define a seman-tic window centered at the verbal predicate with 6 arguments {A −3, A −2, A −1, A 1, A 2, A 3} where A −3− A −1are arguments on the left side of vwhile A 1− A 3are...
- 10
- 561
- 0
Tài liệu Báo cáo khoa học: "Modeling Wisdom of Crowds Using Latent Mixture of Discriminative Experts" docx
... (Ozkan et al.,2010): lexical, prosodic, part-of-speech, syntactic,and visual.Random Classifier Our last baseline model is a ran-dom backchannel generator as desribed by Wardand Tsukahara (2000). ... an absolute gold standard.Snow et. al. (2008) show that using non-expert la-bels for training machine learning algorithms can beas effective as using a gold standard annotation.In this paper, ... Huanget al. (2010) showed that a virtual human driven byPCS approach creates significantly more rapport andis perceived as more believable than the virtual hu-man driven by face-to-face interaction...
- 6
- 346
- 0
Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ