Báo cáo khoa học: "Comparing Objective and Subjective Measures of Usability in a Human-Robot Dialogue System" potx
Báo cáo khoa học: Efficient and targeted delivery of siRNA in vivo pdf
... Natl Cancer Inst 100, 109–120.77 Minakuchi Y, Takeshita F, Kosaka N, Sasaki H,Yamamoto Y, Kouno M, Honma K, Nagahara S,Hanai K, Sano A et al. (2004) Atelocollagen-mediatedsynthetic small interfering ... that RNA aptamers can befacilely obtained by in vitro transcription reaction and, therefore, avoid contamination by cell or bacterialproducts. Promising in vitro and in vivo RNAi wasobtained ... J-P, SoriaJ et al. (2006) Intravenous delivery of anti-RhoAsmall interfering RNA loaded in nanoparticles of chitosan in mice: safety and efficacy in xenograftedaggressive breast cancer. Hum...
- 14
- 599
- 0
Báo cáo khoa học: Comparing the substrate specificities of cytochrome c biogenesis Systems I and II docx
... addition of a few grains of disodium dithionite. The Soret and a- band absorbance maxima areat 415 and 550 nm, respectively, for wild-type cytochrome c550, and at around 419 and 555 nm for the AXXAH-containing ... and CcmB are not involved in hemetransport in E. coli [44,45]. Notably, maturation of anAXXAH-containing variant b -type cytochrome c550 in the present study indicates a nascent heme-binding ... spectra of periplasmic extracts of cells containing the System II plasmid and the double-alanine cytochrome c550(AXXAH motif, C3 5A ⁄ C3 8A) indicated the presence of small amounts of a typicallow-spin,...
- 12
- 469
- 0
Tài liệu Báo cáo khoa học: Helix mobility and recognition function of the rat thyroid transcription factor 1 homeodomain – hints from 15N-NMR relaxation studies pdf
... overlapaffecting the corresponding signals. Correlations were calculated bymeans of MATHEMATICA 5.2 software, using the relaxation datasetgiven in supplementary Table S2. Relaxation data obtained ... Universita`di Udine, ItalyHomeodomains (HDs) comprise a very well-knownclass of DNA-binding domains occurring in a largefamily of transcription activators involved in thedetermination of cell ... factor 1 homeodomain – hints from15N-NMRrelaxation studiesDevrim Gu¨mral, Luana Nadalin, Alessandra Corazza, Federico Fogolari, Giuseppe Damante,Paolo Viglino and Gennaro EspositoDipartimento...
- 14
- 744
- 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx
... 275–283.10 Kuwada M, Teramoto T, Kumagaye KY, Nakajima K,Watanabe T, Kawai T, Kawakami Y, Niidome T,Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin-TK containing D-serine at position 46, but ... 2008)doi:10.1111/j.1742-4658.2008.06352.xCone snails, a group of gastropod animals that inhabit tropical seas, arecapable of producing a mixture of peptide neurotoxins, namely conotoxins,for defense and predation. Conotoxins are mainly ... Kubota I, Takao T, Shimonishi Y,Yasuda-Kamatani Y, Minakata H, Nomoto K,Muneoka Y & Kobayashi M (1991) Fulicin, a novelneuropeptide containing a D-amino acid residueisolated from the ganglia...
- 12
- 616
- 0
Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx
... analysis of elafin and trappin-2 fractionatedon heparin-Sepharose. The heparin-binding capacities of elafin and trappin-2 were evaluated by affinity chromatography using heparin-Sepharose. Elafin ... pneumoniae, Branhamella catarrhalis and thepathogenic fungi A. fumigatus and C. albicans. Ourresults indicate that trappin-2 has a broad antibacte-rial activity and is fungicidal for A. fumigatus ... N-terminal domain and is comparable to that of human defensins and human lysozyme.Elafin and trappin-2 are both antimicrobial againstS. aureus and P. aeruginosa [14,15] but not againstE. coli...
- 13
- 610
- 0
Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc
... shortest functional domain from a crenarchaeal plasmid endowed withDNA and RNA synthesis and terminal transferase activity.AbbreviationsAEP, archaeo-eukaryotic replicative primases; dNTP, deoxyribonucleotide; ... replicative primases (AEPs) [11].Primase–polymerases (prim–pols) are a novel family of AEPs which are sporadically found in both bacterio-phages and crenarchaeal and Gram-positive bacterialplasmids. ... proteins. The prim–pol domain and putative heli-case ⁄ NTPase domain are indicated in gray and black respectively.(B) Purification of the recombinant Rep245 protein. SDS ⁄ PAGE of protein extracts...
- 14
- 620
- 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx
... primer and probe1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT2fw ATCCCAGGAAACACCAGTAGA10rev ATTGTTTTCTCTCAAGACCCAATaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG18Sfw CGCCGCTAGAGGTGAAATTC18Srev TCTTGGCAAATGCTTTCGCTTaqMan ... kit (Stratagene, La Jolla,CA, USA). Mutagenic primers were: 5¢-CGCTCGAGATGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCTATTCTACCAAAAGAATGGCC-3¢ and its ... fw, forward; rev,reverse.SequenceACMSD cloning: primer1fw CGCTCGAGATGAAAATTGACATCCATAGTCAT11rev AAAGCTGAGCTCCATTCAAATTGTTTTCTCTCAAG4fw TTCTCGAGATGGGAAAGTCTTCAGAGTGGTACMSD real-time...
- 14
- 601
- 0
Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx
... sequencing. Accordingto the sequencing result, a pair of PCR primers (sense:5¢-GCGCATCCATATGAAATTAAAATCGTTTGG-3¢ and antisense: 5¢-CCGCTCGAGAAAAACGCTTCGCATGAC-3¢) were synthesized to clone aroE gene ... performed at 4 °C. Protein concentrationwas determined by Bradford assay using bovine serumalbumin as standard.Enzymatic activity assayThe enzymatic activity of HpSDH was assayed at 25 °Cbymonitoring ... NdeI and XhoI (Takara, Dalian, China), and cloned into a prokaryotic expression vector pET-22b(Novagen, Madison, WI, USA) to produce the recombinantplasmid pET22b-HpSDH containing a C-terminal...
- 11
- 529
- 0
Tài liệu Báo cáo khoa học: Receptor association and tyrosine phosphorylation of S6 kinases pdf
... phosphatase 2A interacts with the70-kDa S6 kinase and is activated by inhibition of FKBP12-rapamycinassociated protein. Proc Natl AcadSci USA 96, 4438–4442.11 Petritsch C, Beug H, Balmain A & ... stimulated forvarious times, fixed and stained with an antibodyagainst the C-terminus of S6K1. Using an fluorosceinisothiocyanate (FITC)-labeled secondary anti-rabbitIgG and phalloidin to stain actin, ... ⁄ Akt), protein kinase C (PKCs), p90 ribosomalS6 kinase and 3-phosphoinositide-dependent proteinkinase-1 (PDK1). AGC kinases share a high homology in their kinase domains and have a similar...
- 14
- 630
- 0
Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt
... Helena Yusuf-Makagiansar3, Vincent T. K. Chow2, Teruna J. Siahaan3 and Seetharama D. S. Jois11Department of Pharmacy and 2Department of Microbiology, National University of Singapore, Singapore;3Department ... 10% (w/v) heat-inactivated fetal bovine serum and 100 mgÆL)1 of penicillin/streptomycin. Caco-2 cells were maintained in minimumessential m edium -a containing 10% (w/v) f etal bovineserum, ... T-leukemia and the human colonadenocarcinoma (Caco-2) cell lines were obtained from theAmerican Type Culture Collection (Rockville, MD, USA).Jurkat and M OLT-3 cells were maintained in suspension in RPMI1640...
- 14
- 657
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ