Báo cáo khoa học: "Jointly optimizing a two-step conditional random field model for machine transliteration and its fast decoding algorithm" pdf
Báo cáo khoa học: "Jointly optimizing a two-step conditional random field model for machine transliteration and its fast decoding algorithm" pdf
... Japan{raymond,dixonp,furui}@furui.cs.titech.ac.jpAbstractThis paper presents a joint optimizationmethod of a two-step conditional random field (CRF) model for machine transliter-ation and a fast decoding algorithm for the proposed ... context information into the model for 275Indian languages. In the “NEWS 2009 Machine Transliteration Shared Task”, a new two-step CRF model for transliteration task has been proposed(Yang et al., ... model for machine transliteration and its fast decoding algorithmDong Yang, Paul Dixon and Sadaoki FuruiDepartment of Computer ScienceTokyo Institute of TechnologyTokyo 152-8552 Japan{raymond,dixonp,furui}@furui.cs.titech.ac.jpAbstractThis...
- 6
- 419
- 0
Báo cáo khoa học: "Improving the Performance of the Random Walk Model for Answering Complex Questions" pptx
... the random walk model for answering complex ques-tions. We argue that for this task, similarity mea-sures based on syntactic and semantic informationperforms better and can be used to characterize ... the9relation between a question and a sentence (answer)in a more effective way than the traditional TF*IDFbased similarity measures.2 Graph-based Random Walk Model for Text SummarizationIn (Erkan ... words and does not take into account the sequence,syntactic and semantic information. In this pa-per, we study the impact of syntactic and shal-low semantic information in the graph-basedmethod...
- 4
- 456
- 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... 111–127.13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997)Gene cluster for dissimilatory nitrite reductase (nir)from Pseudomonas aeruginosa: sequencing and identifi-cation of a locus for heme ... 252.221.81.41.21.610.80.60.40.20 A 600 A 600 A 600Time (h)Fig. 5. His41 is essential for Paracoc-cus pantotrophus NirF, but Asp129 is dis-pensable. Growth plots and time courses ofnitrite appearance and disappearance for P. ... article.Please note: As a service to our authors and readers,this journal provides supporting information suppliedby the authors. Such materials are peer-reviewed and may be re-organized for...
- 12
- 613
- 0
Báo cáo khoa học: DmGEN shows a flap endonuclease activity, cleaving the blocked-flap structure and model replication fork docx
... GTCGACCTGCAGCCCAAGCTTGCGTTGCTG A- flap ATGTGGAAAATCTCTAGCAGGCTGCAGGTCGACB-flap CAGCAACGCAAGCTTGATGTGGAAAATCTCTAGCAB-g1 CAGCAACGCAAGCTTB-g2 CAGCAACGCAAGCTB-g4 CAGCAACGCAAG A- b15 AGAGATTTTCCACAT A- b17 CTAGAGATTTTCCACAT A- b19 ... CGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTCX3 GACGTCATAGACGATTACATTGCTAGGACATGCTGTCTAGAGACTATCGCX4 GCGATAGTCTCTAGACAGCATGTCCTAGCAAGCCAGAATTCGGCAGCGTCX1half GGACATCTTTGCCCACGTTGACCCGX1half-g4 ATCTTTGCCCACGTTGACCCGX1half-g8 TTGCCCACGTTGACCCGX4half ... CGGTCAACGTGGGCATACAACGTGGCACTGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATGTCCTAGCAAAGCGTATGTGATCACTGGX1 GACGCTGCCGAATTCTGGCTTGCTAGGACATCTTTGCCCACGTTGACCCGX2 CGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTCX3...
- 14
- 433
- 0
Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt
... PA1b: five susceptiblestrains ÔS. oryzae WAA42, Benin, and Bouriz, S. zeamaisLS, and S. granarius BrayardÕ and four fully resistantS. oryzae strains ÔISOR3, Mex1, China and GVÕ harboring a ... specific radioactivity of the125I-labelledPA1b, calculated by the ratio of the radioactivity measuredby gamma counting and the amount of peptide evaluated byabsorbance at 210 nm during HPLC analysis, ... ligand rangingfrom 0.35 to 3.2 nM. The saturation plot showed that thespecific binding was saturable, and the deduced Scatchardplot revealed a Kdof 2.6 nM and a maximal bindingcapacity...
- 7
- 604
- 0
Báo cáo khoa học: DYNLL/LC8: a light chain subunit of the dynein motor complex and beyond pptx
... Wickstead B & Gull K (2007) Dyneins across eukary-otes: a comparative genomic analysis. Traffic 8, 1708–1721.3 Sakakibara H & Oiwa K (2011) Molecular organiza-tion and force-generating ... 8172–8179.11 Navarro C, Puthalakath H, Adams JM, Strasser A &Lehmann R (2004) Egalitarian binds dynein light chainto establish oocyte polarity and maintain oocyte fate.Nat Cell Biol 6, ... FEBS88 Haraguchi K, Satoh K, Yanai H, Hamada F, Kawabu-chi M & Akiyama T (2000) The hDLG-associated pro-tein DAP interacts with dynein light chain and neuronal nitric oxide synthase. Genes...
- 17
- 573
- 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... worksimage acquisition and analysis software was used to quan-tify band intensities. Antibodies were purchased from Tian-jin Saier Biotech and Sigma-Aldrich.Statistical analysisData are expressed ... HepG2 and QGY-7703 cells by gain and loss of function approaches. MTT, colony forma-tion and growth curve assays show that miR-373 canincrease the growth of those cells, and FACS analysisindicates ... genes arefrequently located at fragile sites and genomic regionsinvolved in cancers. Proc Natl Acad Sci USA 101,2999–3004.18 Yang K, Handorean AM & Iczkowski KA (2009) Mi-croRNAs 373 and...
- 11
- 396
- 0
Báo cáo khoa học: "MIMA Search: A Structuring Knowledge System towards Innovation for Engineering Education" pot
... class of term variants, not for each term variant separately. Table 1: Automatic term normalization Term variants Normalised term human cancers cancer in humans human’s cancer human ... morphological, syntactic, lexico-semantic and pragmatic phenomena. Our approach to term variation management is based on term normali-zation as an integral part of the ATR process. Term variants (i.e. ... ex-tracted terms). Each term variant is normalized (see table 1 as an example) and term variants hav-ing the same normalized form are then grouped into classes in order to link each term candidate...
- 4
- 184
- 0
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf
... 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUAACAAUGUGAAAGCAAUGUGAUA 5′3′UAAAUGUGAAUACUAAGAGUAAGCAAUGUGAUAIL6R mRNA mut 1 5′3′UAAAUGUGAAUACAAUGUGAAA GCUAAGAGUUAIL6R ... (A) and colonyformation (B) assays (*P < 0.05).25215′3′5′3′5′3′5′CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA3′UAAAUGUGAAUACAAUGUGAAAGCAAUGUGAUAIL6R mRNAmiR-2 3a ... 5′3′3′UAUAAGAGUAUCCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ 5′ 3′ 5′ 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ 5′ 3′ 5′ 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUAACAAUGUGAAAGCAAUGUGAUA...
- 9
- 541
- 0
Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx
... and Manca Kenig for cloning and isolating the recombinant proteins. Wealso are grateful to Sabina Rabzelj and Sasˇ a JenkoKokalj for performing certain SEC experiments and for activity measurements. ... misfolding, aggregation and amyloid fibril forma-tion of a pathological mutant (in inherited diseases), orof a normal protein or its normal variant (in sporadiccases). Amyloid fibril formation is regarded ... undergoes a conform-ational change and amyloid fibril formation. We show that copper bindinginhibits the amyloid fibril formation and, to a lesser degree, the initialaggregation. Similarities to and...
- 14
- 586
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam