Báo cáo khoa học: Aly⁄ REF, a factor for mRNA transport, activates RH gene promoter function pptx
Báo cáo khoa học: Aly⁄ REF, a factor for mRNA transport, activates RH gene promoter function pptx
... Aly⁄ REF, a factor for mRNA transport, activates RH gene promoter function Hiroshi Suganuma1, Maki Kumada1, Toshinori Omi1, Takaya Gotoh1, Munkhtulga Lkhagvasuren1,Hiroshi Okuda1,2, ... 5¢-CTGGTCGCAGCTTAGGAACAG-3¢ and antisense, 5¢-AATGTTCATGGGGCGGCCATC-3¢, for RH: sense, 5¢-GCAACGATACCCAGTTTGTC-3¢ and antisense, 5¢-AGTTGACACTTGGCCAGAAC-3¢. The relative amounts of Aly ⁄ REF and RH wereassessed as ... we preparedthe following mutant probe: biotin- 5¢-GGGACTATGATGATGGGTTTGTGAGGAAATGT-3¢ and 5¢-ACATTTCCTCACAAACCCATCATAGTCCC-3¢. HEL cell nuclearproteins carried by the probes were separated...
- 9
- 362
- 0
Báo cáo khoa học: "Iterative Viterbi A* Algorithm for K-Best Sequential Decoding" docx
... similar tothe forward one and it is thus omitted.The alternative calls of forward and backwardpasses (in Algorithm 1) ensure the alternative updat-ing/lowering of node forward and backward ... same accuracy. The accu-racy we get for the first four tasks is comparable tothe state-of-the-art. We do not have a baseline tocompare with for the last dataset as it is not pub-licly available7. ... bigrams for POS, CoNLL2000and CoNLL 2003 datasets. For supertag dataset,we use the same features for the word inputs, andthe unigrams and bigrams for gold POS inputs. For search query dataset,...
- 9
- 510
- 0
Báo cáo khoa học: "An Exact A* Method for Deciphering Letter-Substitution Ciphers" doc
... probabilities and the probability of the path at starting at (a) .In all of the data considered, the frequency ofspaces was far higher than that of any other char-acter, and so in any real application ... re-trieval and data mining, in which case it is impor-tant to be able to read through them automatically,without resorting to a human annotator. The holygrail in this area would be an application ... exponen-tial in the size of the cipher and plain text alpha-bets), and has the additional advantage of beingmassively parallelizable. (Ravi and Knight, 2008)also seem to believe that short...
- 8
- 350
- 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf
... Bando R, Hieda N & Toraya T (2004)Identification of a reactivating factor for adenosylcobalamin-dependent ethanolamine ammonialyase. J Bacteriol 186, 6845–6854.27 Baker JJ & Stadiman ... K, Hieda N, Yamanishi M, Shibata N &Toraya T (2005) Crystallization and preliminary X-rayanalysis of molecular chaperone-like diol dehydratase-reactivating factor in ADP-bound and nucleotide-freeforms. ... (an inactive coenzyme analog lacking the ade-nine ring in the upper axial ligand; a model of damagedcofactors) for free adeninylpentylcobalamin (AdePeCbl)(an inactive coenzyme analog containing...
- 13
- 620
- 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... Seligman PA & Allen RH (1978) Characterization ofthe receptor for transcobalamin II isolated from humanplacenta. J Biol Chem 253, 1766–1772.22 Quadros EV, Nakayama Y & Sequeira JM (2005) ... Clinical Biochemistry, AS Aarhus University Hospital, DenmarkCobalamin (Cbl, vitamin B12) is a cofactor for twocrucial enzymes in mammals [1]. Therefore, anenhanced influx of the vitamin is ... 4753Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalaminand intrinsic factor Sergey N. Fedosov1, Charles...
- 12
- 603
- 0
Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc
... Healthcare).Caspase 9 activity assayCaspase 9 activity was examined according to the instruc-tion manual of the Caspase 9 ⁄ Mch6 Fluorometric ProteaseAssay kit (Medical and Biological Laboratories ... Bcl-XLexpression, and the resistance against ADR-induced apop-tosis, suggesting that EGF transmitted the antiapoptotic signal in such a way that it activated AP1 via a MAP kinase signaling pathway. TMK-1cells ... andcaspase 9. (C) Cells were treated with EGF and ADR as describedin (A) . Lysates were prepared at the indicated times after the ADRaddition and analyzed for caspase 9 activity by using a fluorometricsubstrate-based...
- 13
- 493
- 0
Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf
... GTCGGATCCGCGGATCAGGTGGGGATGTATTA; rnc5¢I comp,GGCAGTGGATGATGGGGTTCATGCGATACC; rnc3¢OSalI, TGCGTCGACATTTGCCGCAATAGTGTCAACA;and rnc3¢I comp, TGAACCCCATCATCCACTGCCAGGTCAGCG. The deletion was constructed ... follows: era_F_NcoI, CGACCATGGCGAACAGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGACAGCCTTCCATCGGAGTTACT. The resulting vectorwas termed pTrc9 9a: :era. Protein overexpression wasassayed by SDS ⁄ PAGE.Selection ... Natl Acad Sci USA 81, 185–188.17 Croitoru V, Bucheli-Witschel M, Hagg P, Abdulkarim F& Isaksson LA (2004) Generation and characterizationof functional mutants in the translation initiation...
- 12
- 439
- 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
... acid (FA) is a bacteriostatic antibiotic that locks elongation factor G(EF-G) on the ribosome in a post-translocational state. It is used clinicallyagainst Gram-positive bacteria such as pathogenic ... & Andersen GR (2003) Two crystal struc-tures demonstrate large conformational changes in theeukaryotic ribosomal translocase. Nat Struct Biol10,379–385.30 Al Karadaghi S, Aevarsson A, ... fusidic acidYang Chen, Ravi Kiran Koripella, Suparna Sanyal and Maria SelmerDepartment of Cell and Molecular Biology, Uppsala University, SwedenIntroductionProtein synthesis, translation of mRNA...
- 15
- 474
- 0
Báo cáo khoa học: Human mitochondrial transcription factor A possesses multiple subcellular targeting signals pptx
... Humanmitochondrial transcription factor A (mtTFA): gene structure and characterization of related pseudogenes. Gene 291, 223–232.4 Tominaga K, Hayashi J, Kagawa Y & Ohta S (1993)Smaller isoform of human ... T, Muta T, Ukaji K, Abe Y, Nakay-ama H, Takio K, Hamasaki N & Kang D (2003)Human mitochondrial DNA is packaged with TFAM.Nucleic Acids Res 31, 1640–1645.16 Takamatsu C, Umeda S, Ohsato ... transcription factor A and differen-tially regulates binding to damaged DNA. Cancer Res63, 3729–3734.19 Dinardo MM, Musicco C, Fracasso F, Milella F,Gadaleta MN, Gadaleta G & Cantatore P (2003) Acety-lation...
- 12
- 291
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ